ID: 1177626374

View in Genome Browser
Species Human (GRCh38)
Location 21:23665719-23665741
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177626372_1177626374 4 Left 1177626372 21:23665692-23665714 CCCATATATGACAGGCTCAGAAT No data
Right 1177626374 21:23665719-23665741 CATCCTATCTTTAGTAAGTTAGG No data
1177626373_1177626374 3 Left 1177626373 21:23665693-23665715 CCATATATGACAGGCTCAGAATT No data
Right 1177626374 21:23665719-23665741 CATCCTATCTTTAGTAAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177626374 Original CRISPR CATCCTATCTTTAGTAAGTT AGG Intergenic
No off target data available for this crispr