ID: 1177626375

View in Genome Browser
Species Human (GRCh38)
Location 21:23665722-23665744
Sequence TCTCCTAACTTACTAAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177626375_1177626379 29 Left 1177626375 21:23665722-23665744 CCTATCTTTAGTAAGTTAGGAGA No data
Right 1177626379 21:23665774-23665796 TAATAGCAATGATCAGAGAGGGG No data
1177626375_1177626377 27 Left 1177626375 21:23665722-23665744 CCTATCTTTAGTAAGTTAGGAGA No data
Right 1177626377 21:23665772-23665794 TATAATAGCAATGATCAGAGAGG No data
1177626375_1177626378 28 Left 1177626375 21:23665722-23665744 CCTATCTTTAGTAAGTTAGGAGA No data
Right 1177626378 21:23665773-23665795 ATAATAGCAATGATCAGAGAGGG No data
1177626375_1177626376 -5 Left 1177626375 21:23665722-23665744 CCTATCTTTAGTAAGTTAGGAGA No data
Right 1177626376 21:23665740-23665762 GGAGAAAGTAACAGTAGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177626375 Original CRISPR TCTCCTAACTTACTAAAGAT AGG (reversed) Intergenic