ID: 1177626376

View in Genome Browser
Species Human (GRCh38)
Location 21:23665740-23665762
Sequence GGAGAAAGTAACAGTAGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177626375_1177626376 -5 Left 1177626375 21:23665722-23665744 CCTATCTTTAGTAAGTTAGGAGA No data
Right 1177626376 21:23665740-23665762 GGAGAAAGTAACAGTAGCAATGG No data
1177626373_1177626376 24 Left 1177626373 21:23665693-23665715 CCATATATGACAGGCTCAGAATT No data
Right 1177626376 21:23665740-23665762 GGAGAAAGTAACAGTAGCAATGG No data
1177626372_1177626376 25 Left 1177626372 21:23665692-23665714 CCCATATATGACAGGCTCAGAAT No data
Right 1177626376 21:23665740-23665762 GGAGAAAGTAACAGTAGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177626376 Original CRISPR GGAGAAAGTAACAGTAGCAA TGG Intergenic