ID: 1177626604

View in Genome Browser
Species Human (GRCh38)
Location 21:23670308-23670330
Sequence CCAATCATGCAGGTCTTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177626599_1177626604 28 Left 1177626599 21:23670257-23670279 CCATGAAAGGAAATTAATGGCTA No data
Right 1177626604 21:23670308-23670330 CCAATCATGCAGGTCTTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177626604 Original CRISPR CCAATCATGCAGGTCTTAGA GGG Intergenic
No off target data available for this crispr