ID: 1177628697

View in Genome Browser
Species Human (GRCh38)
Location 21:23699757-23699779
Sequence CAAAATGCTGATAGTGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177628694_1177628697 5 Left 1177628694 21:23699729-23699751 CCTAGAGACTTTGTTGAATGTCT No data
Right 1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177628697 Original CRISPR CAAAATGCTGATAGTGATAT GGG Intergenic