ID: 1177628967

View in Genome Browser
Species Human (GRCh38)
Location 21:23701890-23701912
Sequence GTGTCTGTGCAAAGGTAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177628967_1177628970 14 Left 1177628967 21:23701890-23701912 CCATCCTACCTTTGCACAGACAC No data
Right 1177628970 21:23701927-23701949 AAAAGCCTACTTTTGAGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177628967 Original CRISPR GTGTCTGTGCAAAGGTAGGA TGG (reversed) Intergenic
No off target data available for this crispr