ID: 1177628967 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 21:23701890-23701912 |
| Sequence | GTGTCTGTGCAAAGGTAGGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1177628967_1177628970 | 14 | Left | 1177628967 | 21:23701890-23701912 | CCATCCTACCTTTGCACAGACAC | No data | ||
| Right | 1177628970 | 21:23701927-23701949 | AAAAGCCTACTTTTGAGAGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1177628967 | Original CRISPR | GTGTCTGTGCAAAGGTAGGA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||