ID: 1177633191

View in Genome Browser
Species Human (GRCh38)
Location 21:23752774-23752796
Sequence GACCCACGCATTCTTCCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177633189_1177633191 0 Left 1177633189 21:23752751-23752773 CCTGTTTCTTCTCTTTGTTCTTG No data
Right 1177633191 21:23752774-23752796 GACCCACGCATTCTTCCACTTGG No data
1177633185_1177633191 30 Left 1177633185 21:23752721-23752743 CCTCTAGGAATGATGGTGCAAGG No data
Right 1177633191 21:23752774-23752796 GACCCACGCATTCTTCCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177633191 Original CRISPR GACCCACGCATTCTTCCACT TGG Intergenic
No off target data available for this crispr