ID: 1177638198

View in Genome Browser
Species Human (GRCh38)
Location 21:23812831-23812853
Sequence CTCTGTACTCAGCACTGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177638198_1177638203 24 Left 1177638198 21:23812831-23812853 CCTTTTCAGTGCTGAGTACAGAG No data
Right 1177638203 21:23812878-23812900 GTGGTATAGTTGTTCTTGAATGG No data
1177638198_1177638202 5 Left 1177638198 21:23812831-23812853 CCTTTTCAGTGCTGAGTACAGAG No data
Right 1177638202 21:23812859-23812881 CCTCAATATTTTGCTGGTAGTGG No data
1177638198_1177638199 -1 Left 1177638198 21:23812831-23812853 CCTTTTCAGTGCTGAGTACAGAG No data
Right 1177638199 21:23812853-23812875 GTGAACCCTCAATATTTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177638198 Original CRISPR CTCTGTACTCAGCACTGAAA AGG (reversed) Intergenic
No off target data available for this crispr