ID: 1177639328

View in Genome Browser
Species Human (GRCh38)
Location 21:23826160-23826182
Sequence CATCGGAGGGACCCCGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177639314_1177639328 25 Left 1177639314 21:23826112-23826134 CCCACCCAAATCTTTTCTTGAAA No data
Right 1177639328 21:23826160-23826182 CATCGGAGGGACCCCGTGGGAGG No data
1177639315_1177639328 24 Left 1177639315 21:23826113-23826135 CCACCCAAATCTTTTCTTGAAAT No data
Right 1177639328 21:23826160-23826182 CATCGGAGGGACCCCGTGGGAGG No data
1177639317_1177639328 20 Left 1177639317 21:23826117-23826139 CCAAATCTTTTCTTGAAATTTAG No data
Right 1177639328 21:23826160-23826182 CATCGGAGGGACCCCGTGGGAGG No data
1177639319_1177639328 -6 Left 1177639319 21:23826143-23826165 CCATAATCCCCACGTGTCATCGG No data
Right 1177639328 21:23826160-23826182 CATCGGAGGGACCCCGTGGGAGG No data
1177639316_1177639328 21 Left 1177639316 21:23826116-23826138 CCCAAATCTTTTCTTGAAATTTA No data
Right 1177639328 21:23826160-23826182 CATCGGAGGGACCCCGTGGGAGG No data
1177639313_1177639328 26 Left 1177639313 21:23826111-23826133 CCCCACCCAAATCTTTTCTTGAA 0: 7
1: 491
2: 8426
3: 11615
4: 9870
Right 1177639328 21:23826160-23826182 CATCGGAGGGACCCCGTGGGAGG No data
1177639318_1177639328 -5 Left 1177639318 21:23826142-23826164 CCCATAATCCCCACGTGTCATCG No data
Right 1177639328 21:23826160-23826182 CATCGGAGGGACCCCGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177639328 Original CRISPR CATCGGAGGGACCCCGTGGG AGG Intergenic
No off target data available for this crispr