ID: 1177641992

View in Genome Browser
Species Human (GRCh38)
Location 21:23855452-23855474
Sequence CTGGAGACCTAGCTTCATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177641992_1177641994 11 Left 1177641992 21:23855452-23855474 CCTTCATGAAGCTAGGTCTCCAG No data
Right 1177641994 21:23855486-23855508 GTCAGATACTCGAGTCTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177641992 Original CRISPR CTGGAGACCTAGCTTCATGA AGG (reversed) Intergenic
No off target data available for this crispr