ID: 1177642020

View in Genome Browser
Species Human (GRCh38)
Location 21:23855712-23855734
Sequence GCCCATGCCCTGATGATGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177642020_1177642023 12 Left 1177642020 21:23855712-23855734 CCTGTCATCATCAGGGCATGGGC No data
Right 1177642023 21:23855747-23855769 ATTATTCTAGGGAGAAGAGATGG No data
1177642020_1177642024 13 Left 1177642020 21:23855712-23855734 CCTGTCATCATCAGGGCATGGGC No data
Right 1177642024 21:23855748-23855770 TTATTCTAGGGAGAAGAGATGGG No data
1177642020_1177642022 1 Left 1177642020 21:23855712-23855734 CCTGTCATCATCAGGGCATGGGC No data
Right 1177642022 21:23855736-23855758 AATAAGCATTCATTATTCTAGGG No data
1177642020_1177642021 0 Left 1177642020 21:23855712-23855734 CCTGTCATCATCAGGGCATGGGC No data
Right 1177642021 21:23855735-23855757 AAATAAGCATTCATTATTCTAGG No data
1177642020_1177642025 24 Left 1177642020 21:23855712-23855734 CCTGTCATCATCAGGGCATGGGC No data
Right 1177642025 21:23855759-23855781 AGAAGAGATGGGTTTCAGTGAGG No data
1177642020_1177642026 25 Left 1177642020 21:23855712-23855734 CCTGTCATCATCAGGGCATGGGC No data
Right 1177642026 21:23855760-23855782 GAAGAGATGGGTTTCAGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177642020 Original CRISPR GCCCATGCCCTGATGATGAC AGG (reversed) Intergenic
No off target data available for this crispr