ID: 1177649311

View in Genome Browser
Species Human (GRCh38)
Location 21:23940066-23940088
Sequence AGACTTAAACTGATGCATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177649308_1177649311 27 Left 1177649308 21:23940016-23940038 CCTCAACAAATCTCTAGCACTCT No data
Right 1177649311 21:23940066-23940088 AGACTTAAACTGATGCATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177649311 Original CRISPR AGACTTAAACTGATGCATAT AGG Intergenic
No off target data available for this crispr