ID: 1177650106

View in Genome Browser
Species Human (GRCh38)
Location 21:23949362-23949384
Sequence TCTCATCTGCAGAATGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177650102_1177650106 -5 Left 1177650102 21:23949344-23949366 CCTCAGCAAGCCTCATTGTCTCA No data
Right 1177650106 21:23949362-23949384 TCTCATCTGCAGAATGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177650106 Original CRISPR TCTCATCTGCAGAATGGGCA TGG Intergenic
No off target data available for this crispr