ID: 1177650889

View in Genome Browser
Species Human (GRCh38)
Location 21:23961010-23961032
Sequence CTGAATATACAAAGGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177650889_1177650896 26 Left 1177650889 21:23961010-23961032 CCATTGTCCCTTTGTATATTCAG No data
Right 1177650896 21:23961059-23961081 TTTTCTAACCTTTATCAACTTGG 0: 1
1: 0
2: 3
3: 29
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177650889 Original CRISPR CTGAATATACAAAGGGACAA TGG (reversed) Intergenic
No off target data available for this crispr