ID: 1177654968

View in Genome Browser
Species Human (GRCh38)
Location 21:24004951-24004973
Sequence GCTGTAAAGATACCAAAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177654968_1177654969 -6 Left 1177654968 21:24004951-24004973 CCACATTTTGGTATCTTTACAGC No data
Right 1177654969 21:24004968-24004990 TACAGCAGCCCTCCACCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177654968 Original CRISPR GCTGTAAAGATACCAAAATG TGG (reversed) Intergenic
No off target data available for this crispr