ID: 1177659159

View in Genome Browser
Species Human (GRCh38)
Location 21:24060473-24060495
Sequence TTTTTAAATTACCCAGTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 48342
Summary {0: 79, 1: 7218, 2: 15175, 3: 14814, 4: 11056}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177659159_1177659161 12 Left 1177659159 21:24060473-24060495 CCTGAGACTGGGTAATTTAAAAA 0: 79
1: 7218
2: 15175
3: 14814
4: 11056
Right 1177659161 21:24060508-24060530 AGTTGACTCACAGCTCCCCACGG No data
1177659159_1177659163 17 Left 1177659159 21:24060473-24060495 CCTGAGACTGGGTAATTTAAAAA 0: 79
1: 7218
2: 15175
3: 14814
4: 11056
Right 1177659163 21:24060513-24060535 ACTCACAGCTCCCCACGGCTGGG No data
1177659159_1177659162 16 Left 1177659159 21:24060473-24060495 CCTGAGACTGGGTAATTTAAAAA 0: 79
1: 7218
2: 15175
3: 14814
4: 11056
Right 1177659162 21:24060512-24060534 GACTCACAGCTCCCCACGGCTGG No data
1177659159_1177659165 21 Left 1177659159 21:24060473-24060495 CCTGAGACTGGGTAATTTAAAAA 0: 79
1: 7218
2: 15175
3: 14814
4: 11056
Right 1177659165 21:24060517-24060539 ACAGCTCCCCACGGCTGGGGAGG No data
1177659159_1177659164 18 Left 1177659159 21:24060473-24060495 CCTGAGACTGGGTAATTTAAAAA 0: 79
1: 7218
2: 15175
3: 14814
4: 11056
Right 1177659164 21:24060514-24060536 CTCACAGCTCCCCACGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177659159 Original CRISPR TTTTTAAATTACCCAGTCTC AGG (reversed) Intergenic
Too many off-targets to display for this crispr