ID: 1177659162

View in Genome Browser
Species Human (GRCh38)
Location 21:24060512-24060534
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177659159_1177659162 16 Left 1177659159 21:24060473-24060495 CCTGAGACTGGGTAATTTAAAAA 0: 79
1: 7218
2: 15175
3: 14814
4: 11056
Right 1177659162 21:24060512-24060534 GACTCACAGCTCCCCACGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177659162 Original CRISPR GACTCACAGCTCCCCACGGC TGG Intergenic
No off target data available for this crispr