ID: 1177660123

View in Genome Browser
Species Human (GRCh38)
Location 21:24071976-24071998
Sequence CTTTGCCAATGTAATTAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177660123_1177660126 18 Left 1177660123 21:24071976-24071998 CCAATTTAATTACATTGGCAAAG No data
Right 1177660126 21:24072017-24072039 GTCACATTCACAGATTCTAGTGG No data
1177660123_1177660127 19 Left 1177660123 21:24071976-24071998 CCAATTTAATTACATTGGCAAAG No data
Right 1177660127 21:24072018-24072040 TCACATTCACAGATTCTAGTGGG No data
1177660123_1177660124 -4 Left 1177660123 21:24071976-24071998 CCAATTTAATTACATTGGCAAAG No data
Right 1177660124 21:24071995-24072017 AAAGATGCTATTTCCAGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177660123 Original CRISPR CTTTGCCAATGTAATTAAAT TGG (reversed) Intergenic
No off target data available for this crispr