ID: 1177663028

View in Genome Browser
Species Human (GRCh38)
Location 21:24112622-24112644
Sequence CAGAGCTAGCACACAAAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177663028_1177663033 9 Left 1177663028 21:24112622-24112644 CCAACTTTTGTGTGCTAGCTCTG No data
Right 1177663033 21:24112654-24112676 TCTATATTTATAAAGTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177663028 Original CRISPR CAGAGCTAGCACACAAAAGT TGG (reversed) Intergenic
No off target data available for this crispr