ID: 1177663033

View in Genome Browser
Species Human (GRCh38)
Location 21:24112654-24112676
Sequence TCTATATTTATAAAGTTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177663028_1177663033 9 Left 1177663028 21:24112622-24112644 CCAACTTTTGTGTGCTAGCTCTG No data
Right 1177663033 21:24112654-24112676 TCTATATTTATAAAGTTTCCAGG No data
1177663027_1177663033 28 Left 1177663027 21:24112603-24112625 CCTTGTTAATTAATTGCTTCCAA No data
Right 1177663033 21:24112654-24112676 TCTATATTTATAAAGTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177663033 Original CRISPR TCTATATTTATAAAGTTTCC AGG Intergenic
No off target data available for this crispr