ID: 1177663098

View in Genome Browser
Species Human (GRCh38)
Location 21:24113507-24113529
Sequence AACATTTTAAAGTTTGTTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177663098_1177663100 10 Left 1177663098 21:24113507-24113529 CCACGAACAAACTTTAAAATGTT No data
Right 1177663100 21:24113540-24113562 TGTCAGCAAGTCTCCAGAAGAGG No data
1177663098_1177663106 21 Left 1177663098 21:24113507-24113529 CCACGAACAAACTTTAAAATGTT No data
Right 1177663106 21:24113551-24113573 CTCCAGAAGAGGGAGTTGGGGGG No data
1177663098_1177663103 18 Left 1177663098 21:24113507-24113529 CCACGAACAAACTTTAAAATGTT No data
Right 1177663103 21:24113548-24113570 AGTCTCCAGAAGAGGGAGTTGGG No data
1177663098_1177663102 17 Left 1177663098 21:24113507-24113529 CCACGAACAAACTTTAAAATGTT No data
Right 1177663102 21:24113547-24113569 AAGTCTCCAGAAGAGGGAGTTGG No data
1177663098_1177663105 20 Left 1177663098 21:24113507-24113529 CCACGAACAAACTTTAAAATGTT No data
Right 1177663105 21:24113550-24113572 TCTCCAGAAGAGGGAGTTGGGGG No data
1177663098_1177663101 11 Left 1177663098 21:24113507-24113529 CCACGAACAAACTTTAAAATGTT No data
Right 1177663101 21:24113541-24113563 GTCAGCAAGTCTCCAGAAGAGGG No data
1177663098_1177663104 19 Left 1177663098 21:24113507-24113529 CCACGAACAAACTTTAAAATGTT No data
Right 1177663104 21:24113549-24113571 GTCTCCAGAAGAGGGAGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177663098 Original CRISPR AACATTTTAAAGTTTGTTCG TGG (reversed) Intergenic
No off target data available for this crispr