ID: 1177663106

View in Genome Browser
Species Human (GRCh38)
Location 21:24113551-24113573
Sequence CTCCAGAAGAGGGAGTTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177663098_1177663106 21 Left 1177663098 21:24113507-24113529 CCACGAACAAACTTTAAAATGTT No data
Right 1177663106 21:24113551-24113573 CTCCAGAAGAGGGAGTTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177663106 Original CRISPR CTCCAGAAGAGGGAGTTGGG GGG Intergenic
No off target data available for this crispr