ID: 1177667099

View in Genome Browser
Species Human (GRCh38)
Location 21:24174565-24174587
Sequence TAATGTAATCACAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177667099_1177667105 -2 Left 1177667099 21:24174565-24174587 CCCTCTTCCCTGTGATTACATTA No data
Right 1177667105 21:24174586-24174608 TAAGGCTTACCTGGATAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177667099 Original CRISPR TAATGTAATCACAGGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr