ID: 1177667105

View in Genome Browser
Species Human (GRCh38)
Location 21:24174586-24174608
Sequence TAAGGCTTACCTGGATAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177667095_1177667105 19 Left 1177667095 21:24174544-24174566 CCCCTAAATCTCTCTTCCACTCC No data
Right 1177667105 21:24174586-24174608 TAAGGCTTACCTGGATAACCAGG No data
1177667098_1177667105 3 Left 1177667098 21:24174560-24174582 CCACTCCCTCTTCCCTGTGATTA No data
Right 1177667105 21:24174586-24174608 TAAGGCTTACCTGGATAACCAGG No data
1177667100_1177667105 -3 Left 1177667100 21:24174566-24174588 CCTCTTCCCTGTGATTACATTAA No data
Right 1177667105 21:24174586-24174608 TAAGGCTTACCTGGATAACCAGG No data
1177667099_1177667105 -2 Left 1177667099 21:24174565-24174587 CCCTCTTCCCTGTGATTACATTA No data
Right 1177667105 21:24174586-24174608 TAAGGCTTACCTGGATAACCAGG No data
1177667102_1177667105 -9 Left 1177667102 21:24174572-24174594 CCCTGTGATTACATTAAGGCTTA No data
Right 1177667105 21:24174586-24174608 TAAGGCTTACCTGGATAACCAGG No data
1177667103_1177667105 -10 Left 1177667103 21:24174573-24174595 CCTGTGATTACATTAAGGCTTAC No data
Right 1177667105 21:24174586-24174608 TAAGGCTTACCTGGATAACCAGG No data
1177667097_1177667105 17 Left 1177667097 21:24174546-24174568 CCTAAATCTCTCTTCCACTCCCT No data
Right 1177667105 21:24174586-24174608 TAAGGCTTACCTGGATAACCAGG No data
1177667096_1177667105 18 Left 1177667096 21:24174545-24174567 CCCTAAATCTCTCTTCCACTCCC No data
Right 1177667105 21:24174586-24174608 TAAGGCTTACCTGGATAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177667105 Original CRISPR TAAGGCTTACCTGGATAACC AGG Intergenic
No off target data available for this crispr