ID: 1177667255

View in Genome Browser
Species Human (GRCh38)
Location 21:24176497-24176519
Sequence CAGCCATTTTGTTTTAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177667255_1177667257 5 Left 1177667255 21:24176497-24176519 CCTGGCTTAAAACAAAATGGCTG No data
Right 1177667257 21:24176525-24176547 GAGAATTTATATCATTGACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177667255 Original CRISPR CAGCCATTTTGTTTTAAGCC AGG (reversed) Intergenic