ID: 1177667257

View in Genome Browser
Species Human (GRCh38)
Location 21:24176525-24176547
Sequence GAGAATTTATATCATTGACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177667247_1177667257 25 Left 1177667247 21:24176477-24176499 CCTGTCCCAGAAATTTACCCCCT No data
Right 1177667257 21:24176525-24176547 GAGAATTTATATCATTGACTAGG No data
1177667250_1177667257 19 Left 1177667250 21:24176483-24176505 CCAGAAATTTACCCCCTGGCTTA No data
Right 1177667257 21:24176525-24176547 GAGAATTTATATCATTGACTAGG No data
1177667253_1177667257 7 Left 1177667253 21:24176495-24176517 CCCCTGGCTTAAAACAAAATGGC No data
Right 1177667257 21:24176525-24176547 GAGAATTTATATCATTGACTAGG No data
1177667249_1177667257 20 Left 1177667249 21:24176482-24176504 CCCAGAAATTTACCCCCTGGCTT No data
Right 1177667257 21:24176525-24176547 GAGAATTTATATCATTGACTAGG No data
1177667251_1177667257 8 Left 1177667251 21:24176494-24176516 CCCCCTGGCTTAAAACAAAATGG No data
Right 1177667257 21:24176525-24176547 GAGAATTTATATCATTGACTAGG No data
1177667255_1177667257 5 Left 1177667255 21:24176497-24176519 CCTGGCTTAAAACAAAATGGCTG No data
Right 1177667257 21:24176525-24176547 GAGAATTTATATCATTGACTAGG No data
1177667254_1177667257 6 Left 1177667254 21:24176496-24176518 CCCTGGCTTAAAACAAAATGGCT No data
Right 1177667257 21:24176525-24176547 GAGAATTTATATCATTGACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177667257 Original CRISPR GAGAATTTATATCATTGACT AGG Intergenic