ID: 1177671030

View in Genome Browser
Species Human (GRCh38)
Location 21:24227707-24227729
Sequence ATGCTGTTAGAGTTTGGATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177671027_1177671030 18 Left 1177671027 21:24227666-24227688 CCACAAATGTTTTAGAATTGCTT No data
Right 1177671030 21:24227707-24227729 ATGCTGTTAGAGTTTGGATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177671030 Original CRISPR ATGCTGTTAGAGTTTGGATA GGG Intergenic
No off target data available for this crispr