ID: 1177674489

View in Genome Browser
Species Human (GRCh38)
Location 21:24278929-24278951
Sequence GAGCAAAAGGAGAAGTATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177674479_1177674489 28 Left 1177674479 21:24278878-24278900 CCGCAAAAACTCCAGCCATCACA No data
Right 1177674489 21:24278929-24278951 GAGCAAAAGGAGAAGTATTCTGG No data
1177674484_1177674489 13 Left 1177674484 21:24278893-24278915 CCATCACATGGGTGTTTCAGGCA No data
Right 1177674489 21:24278929-24278951 GAGCAAAAGGAGAAGTATTCTGG No data
1177674482_1177674489 17 Left 1177674482 21:24278889-24278911 CCAGCCATCACATGGGTGTTTCA No data
Right 1177674489 21:24278929-24278951 GAGCAAAAGGAGAAGTATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177674489 Original CRISPR GAGCAAAAGGAGAAGTATTC TGG Intergenic
No off target data available for this crispr