ID: 1177678857

View in Genome Browser
Species Human (GRCh38)
Location 21:24337949-24337971
Sequence CTGTGTCCCTTCATTAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177678854_1177678857 7 Left 1177678854 21:24337919-24337941 CCTCACAAATGCCTTTGCTGCTG No data
Right 1177678857 21:24337949-24337971 CTGTGTCCCTTCATTAAAGAAGG No data
1177678855_1177678857 -4 Left 1177678855 21:24337930-24337952 CCTTTGCTGCTGTTGTTGCCTGT No data
Right 1177678857 21:24337949-24337971 CTGTGTCCCTTCATTAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177678857 Original CRISPR CTGTGTCCCTTCATTAAAGA AGG Intergenic
No off target data available for this crispr