ID: 1177681220

View in Genome Browser
Species Human (GRCh38)
Location 21:24374140-24374162
Sequence AATTTTGTATACAGGGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177681220_1177681225 7 Left 1177681220 21:24374140-24374162 CCAGTTTCCCTGTATACAAAATT No data
Right 1177681225 21:24374170-24374192 GATAACTGTTTTGTTTAAGGAGG 0: 4
1: 189
2: 528
3: 397
4: 440
1177681220_1177681227 18 Left 1177681220 21:24374140-24374162 CCAGTTTCCCTGTATACAAAATT No data
Right 1177681227 21:24374181-24374203 TGTTTAAGGAGGCTAAGGACAGG No data
1177681220_1177681226 13 Left 1177681220 21:24374140-24374162 CCAGTTTCCCTGTATACAAAATT No data
Right 1177681226 21:24374176-24374198 TGTTTTGTTTAAGGAGGCTAAGG No data
1177681220_1177681224 4 Left 1177681220 21:24374140-24374162 CCAGTTTCCCTGTATACAAAATT No data
Right 1177681224 21:24374167-24374189 GCTGATAACTGTTTTGTTTAAGG 0: 6
1: 193
2: 533
3: 406
4: 472

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177681220 Original CRISPR AATTTTGTATACAGGGAAAC TGG (reversed) Intergenic
No off target data available for this crispr