ID: 1177681224

View in Genome Browser
Species Human (GRCh38)
Location 21:24374167-24374189
Sequence GCTGATAACTGTTTTGTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1610
Summary {0: 6, 1: 193, 2: 533, 3: 406, 4: 472}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177681223_1177681224 -4 Left 1177681223 21:24374148-24374170 CCTGTATACAAAATTCTTGGCTG No data
Right 1177681224 21:24374167-24374189 GCTGATAACTGTTTTGTTTAAGG 0: 6
1: 193
2: 533
3: 406
4: 472
1177681220_1177681224 4 Left 1177681220 21:24374140-24374162 CCAGTTTCCCTGTATACAAAATT No data
Right 1177681224 21:24374167-24374189 GCTGATAACTGTTTTGTTTAAGG 0: 6
1: 193
2: 533
3: 406
4: 472
1177681222_1177681224 -3 Left 1177681222 21:24374147-24374169 CCCTGTATACAAAATTCTTGGCT No data
Right 1177681224 21:24374167-24374189 GCTGATAACTGTTTTGTTTAAGG 0: 6
1: 193
2: 533
3: 406
4: 472
1177681219_1177681224 24 Left 1177681219 21:24374120-24374142 CCTTTTCTTCATTCATGAAGCCA No data
Right 1177681224 21:24374167-24374189 GCTGATAACTGTTTTGTTTAAGG 0: 6
1: 193
2: 533
3: 406
4: 472

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177681224 Original CRISPR GCTGATAACTGTTTTGTTTA AGG Intergenic
900723353 1:4195478-4195500 GCTGATAGTTGTTTTGTTTAAGG - Intergenic
901269519 1:7941156-7941178 GCTGATCACTGTTTTGAATTTGG - Intronic
903112068 1:21144213-21144235 ACTGATAACTGTTATTGTTATGG - Intronic
905087681 1:35397061-35397083 TCTCATAACTGTTTCCTTTAAGG - Intronic
905497588 1:38405113-38405135 GCTGATAATTGTTTTGTTTAAGG - Intergenic
905532230 1:38689625-38689647 TCTAATAACTTTTTTATTTATGG + Intergenic
906053798 1:42898566-42898588 GCTGATAATTGTTTTGTTTGAGG + Intergenic
906563839 1:46782242-46782264 GCTGATGATTGTTTTGTTTGAGG + Intronic
906594681 1:47064401-47064423 GCTGACCATTGTTTTGTTTAAGG - Intergenic
906869391 1:49460886-49460908 GCTAATAATTGTTTTGTTTTAGG + Intronic
906877001 1:49550590-49550612 GCTAATAATTGTTTTATTTGAGG + Intronic
907027118 1:51131200-51131222 GCCGTTAATTGTTTTGTATAAGG + Intronic
907285810 1:53378772-53378794 GATAATAACTGCTGTGTTTAAGG + Intergenic
907349322 1:53812959-53812981 GCTGATAATTGTTTTGTTGGAGG - Intronic
907879698 1:58535984-58536006 GATCTTACCTGTTTTGTTTATGG - Intronic
908174935 1:61546279-61546301 GCTGATAATTGTTTTGTTTGAGG + Intergenic
908298736 1:62739605-62739627 GCTGATAATTGTTTTGTTTGAGG - Intergenic
908597465 1:65703806-65703828 GGTGGTAACTATTTTGCTTAGGG + Intergenic
908603035 1:65762165-65762187 GCTGATAACTGTTTCCCTTGAGG - Intergenic
908660519 1:66430500-66430522 GCTGATAATTATTTTGTTTAAGG + Intergenic
908803471 1:67905419-67905441 GCTGATAATTGTTTTGTTTAAGG + Intergenic
908981907 1:69968654-69968676 GCTGATAATTGTGTTGTTTGAGG - Intronic
909235143 1:73143380-73143402 GCTAATAATTGTTTTGTTTAAGG + Intergenic
909511190 1:76454571-76454593 GCTGATAGTTGTTTTGTTTAAGG + Intronic
909673815 1:78216393-78216415 GCTGATAATTGTTTTGTTTGAGG - Intergenic
909791032 1:79678728-79678750 GCTGATAATTGTTTCGCTTAAGG + Intergenic
909813181 1:79957104-79957126 GCTGACAATTGTTTTGATTTTGG - Intergenic
909828179 1:80152755-80152777 CCTGATAATTGTTTTGTTTAAGG + Intergenic
909948183 1:81687957-81687979 GCTGACATTTGTTTTGTTTGAGG + Intronic
909981217 1:82103872-82103894 GCTGATAATTGTTTTGTTTGAGG + Intergenic
910232891 1:85004601-85004623 GCTGATAATTGTTTTGTTAGAGG - Intronic
910738816 1:90493297-90493319 GCTGATAATTGTTTTGTTTGAGG + Intergenic
910919413 1:92327943-92327965 GCTGACAGTTGTTTTGTTTAAGG + Intronic
911065934 1:93788599-93788621 GCTGACAATTATTTTGTTTAAGG + Intronic
911265717 1:95741389-95741411 GCTGATAATTGTCTTGTTTCAGG + Intergenic
911318035 1:96377988-96378010 GCTCATAATTGTTCTGCTTAAGG - Intergenic
911562201 1:99419437-99419459 GCTGATAATAGTTTTGTTTAAGG - Intergenic
911678736 1:100690349-100690371 GCTGATAATTATTTTGTTTCAGG + Intergenic
911689308 1:100813849-100813871 GCTGATAATTGCTTTGTTTAAGG - Intergenic
911743432 1:101412458-101412480 CCTGATAATTGTTTTGTTTAAGG - Intergenic
911794259 1:102056401-102056423 GCTGACCATTGTTTTGTTTAAGG - Intergenic
911806021 1:102209721-102209743 GCTGATAATTGTATTGTTTAAGG + Intergenic
912082165 1:105950441-105950463 GCTGATAATTGTTTTGTTTAGGG + Intergenic
912180935 1:107218742-107218764 GCTGATAGTTGTTTTGTTTAAGG + Intronic
912243062 1:107931978-107932000 GCTAATAAATGTTTTTCTTATGG + Intronic
912612290 1:111060665-111060687 GCTGATAGTTGTTTTGCTTAGGG + Intergenic
912615983 1:111100756-111100778 GCTGATAATTGTTTTGTTTGAGG + Intergenic
913035643 1:114962958-114962980 GCTGATAATTATTTTGTTTAAGG + Intronic
913143298 1:115963259-115963281 GCTGATAATTGTTTTGTTTGAGG - Intergenic
913151525 1:116048436-116048458 GCTGATAATTGTTCGGTTTGAGG - Intronic
913337277 1:117720116-117720138 GGTGATAACTATTTTGTTTAAGG - Intergenic
913339567 1:117745624-117745646 GCTGATAATTGTTTTATTTAAGG + Intergenic
913362042 1:117992006-117992028 GATTATATGTGTTTTGTTTATGG - Intronic
913418011 1:118634030-118634052 GCTGATAATTGTTTTGTTTAAGG + Intergenic
913463907 1:119118783-119118805 GCTGATAATTATTTTGTTTAAGG - Intronic
913493685 1:119406579-119406601 GCTGATAATTGTGTCGTTTAAGG - Intergenic
913588039 1:120295731-120295753 GCTAATAATTGTTTTGTTTTAGG + Intergenic
913620146 1:120602638-120602660 GCTAATAATTGTTTTGTTTTAGG - Intergenic
913972877 1:143429172-143429194 GCTGATAATTGTTTTGTTTGAGG + Intergenic
914067261 1:144254779-144254801 GCTGATAATTGTTTTGTTTGAGG + Intergenic
914111892 1:144711575-144711597 GCTGATAATTGTTTTGTTTGAGG - Intergenic
914346234 1:146800841-146800863 GCTGATACTTCTTTTGTTTGAGG - Intergenic
914455362 1:147831785-147831807 GCTGATAATTGTTTTGTTTGAGG + Intergenic
914570055 1:148907604-148907626 GCTAATAATTGTTTTGTTTTAGG + Intronic
914602774 1:149222665-149222687 GCTAATAATTGTTTTGTTTTAGG - Intergenic
914927386 1:151900008-151900030 GCTGATAATTGTTTTGTTTGAGG - Intronic
914968129 1:152279368-152279390 GCTGATAATTGTTTTGTTTGAGG - Intergenic
915055574 1:153125793-153125815 GCTGATAATTATTTTGTTTAAGG - Intergenic
915821470 1:159029278-159029300 GCTGATAATTGTTTTGTTTAAGG + Intronic
916331535 1:163623436-163623458 GCTGATAATTGTTTTGTTTAAGG + Intergenic
916566198 1:165981030-165981052 GCTAATAATTGTTTTGTTTAAGG + Intergenic
916580099 1:166099098-166099120 GCTGATAATTGTTTTGTTAGAGG - Intronic
916661723 1:166928211-166928233 GCTGATAACAGTACTGTTTTAGG - Intronic
917096830 1:171406549-171406571 CCTGATAATTATTTTGTTTAAGG - Intergenic
917167399 1:172127793-172127815 AGTGATAGCTGTTTTGTTTTAGG - Intronic
917319158 1:173760570-173760592 GCTGATAATTGTTTTGTTTGAGG - Intronic
917351370 1:174081463-174081485 GCTAATAATTGTTTTGTTTAAGG - Intergenic
917898296 1:179515361-179515383 GCTGATAATTGTTTTGTTTGAGG + Intronic
917913484 1:179676637-179676659 GCTAATAATTGTTTTGTTTAAGG + Intronic
918172035 1:182006736-182006758 GCTGATAATTGTTTTGTTTAAGG - Intergenic
918467670 1:184837832-184837854 GCTGATTACTGTTTTTTTCTCGG - Intronic
918750634 1:188265320-188265342 GGTGATAATTGTTTTGTTTGAGG + Intergenic
918819585 1:189235691-189235713 GCTGATAATTATTCTGTTTAAGG + Intergenic
918972291 1:191434767-191434789 GCTCATAATTACTTTGTTTAAGG - Intergenic
919073231 1:192782615-192782637 GCTAATAATTGTTTTGTTTGAGG + Intergenic
919115347 1:193274771-193274793 GCTGATAATTGTTTTGTTTGAGG + Intergenic
919278046 1:195446106-195446128 CCTGATAATTGTTTAGTTTGAGG - Intergenic
919281359 1:195494020-195494042 GCTGACAATTATTTTGTTTAAGG + Intergenic
919397750 1:197071442-197071464 GCTGATAATTATTTTTTTTAAGG - Intergenic
919407864 1:197207505-197207527 GCTGATAATTATTTTGTTTAAGG + Intergenic
919426332 1:197436129-197436151 GCTGATAGTTGTTATGTTTTGGG - Intronic
919520399 1:198581293-198581315 GCTTATAATTGTTTTGTTTAAGG + Intergenic
919571756 1:199257662-199257684 GCTGATAATTGTTTTGTTTAAGG + Intergenic
919598604 1:199594753-199594775 GCTAATAATTGTTTTGTTTGAGG - Intergenic
920726796 1:208444033-208444055 GCTGCTAATTGTTTTGTTTGAGG + Intergenic
920800102 1:209178456-209178478 GCTGATAATTGTTTTGCTTAAGG - Intergenic
920989983 1:210927413-210927435 GCTGCTAATTGTTTTGTTTAAGG - Intronic
921532723 1:216305799-216305821 GCCAATAACTGTTTTGTTTAAGG + Intronic
921554151 1:216576719-216576741 CCTGTTAAATATTTTGTTTATGG - Intronic
921762732 1:218935909-218935931 GTTGATTACTGTTGTTTTTAAGG + Intergenic
921788416 1:219261654-219261676 GCTGATAGTTATTTTGTTTGAGG + Intergenic
922395839 1:225200644-225200666 GCTGATAATTGTTTTGTTTAAGG + Intronic
922673212 1:227530981-227531003 GCTGATAATTGTTTTGTTTGAGG + Intergenic
922927195 1:229359718-229359740 GCTGATAACTGCTTTGTTTGAGG + Intergenic
923173833 1:231444347-231444369 GCTGACAATTGTTTTATTTCAGG - Intergenic
923458912 1:234189920-234189942 GCTGATAATTGTTTTGTTTAAGG - Intronic
923648406 1:235847229-235847251 GCTGATAATTGTTTTGTTTGAGG - Intronic
923661800 1:235963609-235963631 GCTGATAACTGTTTTGTTTGAGG - Intergenic
923874868 1:238036116-238036138 GCTGAAAATTGTTTTGTTTGAGG - Intergenic
923960952 1:239083439-239083461 GCTGATAATTGCTTTGTTTAAGG + Intergenic
923996390 1:239499836-239499858 GCTGATAATTGTTTTGTTTGAGG - Intronic
924302150 1:242650785-242650807 GCTGATAATTGTTGTGTTTGAGG + Intergenic
924691709 1:246357669-246357691 GCTGATAATTGTTTTGTTTAAGG - Intronic
924767928 1:247051404-247051426 GCTGACAATTATTTTGTTGAAGG + Intronic
924885222 1:248208609-248208631 GCTAATAATTATTTTATTTAAGG + Intergenic
1062760979 10:18634-18656 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1063725173 10:8629107-8629129 GCTGCTAACTGGTTGATTTATGG + Intergenic
1064237707 10:13591711-13591733 GCTGATAACAATTTTGGTTGAGG + Intronic
1064907973 10:20368807-20368829 GCTGATGATTGTTTTGTTTGAGG + Intergenic
1065462554 10:25983963-25983985 GCTGATAACTGTTTTGTTTAAGG - Intronic
1065470780 10:26079808-26079830 GCTGATAATTGTTTTGTTTGAGG + Intronic
1065671999 10:28129471-28129493 GGAGATAAATTTTTTGTTTAAGG - Intronic
1065894417 10:30150646-30150668 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1066145357 10:32552708-32552730 GCTGATGATTGTTTTGTTTAAGG + Intronic
1066170517 10:32838836-32838858 GCTGATAATTGTTTTATTTAAGG - Intronic
1066459498 10:35600897-35600919 GATAGTAACTGTTTTGTTTTGGG - Intergenic
1066747260 10:38613119-38613141 GCTGATAATTGTTTTGTTCGAGG - Intergenic
1067234043 10:44433350-44433372 GCTGATAATTATTTTGTTTAAGG + Intergenic
1067533873 10:47093999-47094021 GCTTCTAACTGGTTTGTTGAGGG + Intergenic
1067962783 10:50875196-50875218 TCTAATAATTGTTTTGTCTATGG + Intronic
1068096485 10:52498614-52498636 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1068122677 10:52799951-52799973 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1068161803 10:53273780-53273802 GCTGACAATTATTTTGTTTGAGG - Intergenic
1068172952 10:53420257-53420279 GCTGATAATCATTTTGTTTAAGG + Intergenic
1068808681 10:61229574-61229596 GCTGATAATTGCTTTGTTTAAGG - Intergenic
1068924852 10:62525660-62525682 GCTGATAATTGTTTTGTTTAAGG + Intronic
1069129418 10:64680710-64680732 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1069150347 10:64952529-64952551 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1070433887 10:76369400-76369422 CCTGATAATTGTTTTGTTTGAGG + Intronic
1070465084 10:76713177-76713199 ACTGTTAATTGTTTGGTTTAAGG - Intergenic
1070499857 10:77062523-77062545 GATGATGACTGGTTTGTTGAGGG - Intronic
1070507351 10:77125702-77125724 GCTGATGTCTGTTTTGTTCAGGG + Intronic
1071045802 10:81375097-81375119 GTTGATAATTGTTTTATTTAAGG + Intergenic
1071244249 10:83745513-83745535 GTTGAAAACTCTTTTCTTTAAGG + Intergenic
1071405649 10:85328663-85328685 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1071744884 10:88406012-88406034 GCTGATAATTGTTTTGTTTGAGG + Intronic
1071761455 10:88612119-88612141 GGTGATAATTGTTTTGTGTAAGG - Intergenic
1071910808 10:90230708-90230730 GCTGGTAATTGTTTTGTCTGAGG - Intergenic
1072381602 10:94878176-94878198 CCTGACAATTGTTTTGCTTAAGG + Intergenic
1072815070 10:98499354-98499376 ACTGATAATTGTTTTGTTTCAGG - Intronic
1072871810 10:99127845-99127867 GCTGACAATTATTTTGTTTCAGG - Intronic
1072885399 10:99268153-99268175 GCTGATAATTGTTTCATTTAAGG - Intergenic
1072928148 10:99634997-99635019 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1073676607 10:105654431-105654453 GCTAATATCTGTTTTCTTTAGGG - Intergenic
1073701075 10:105927115-105927137 GCTGATAATTCTTTTGTTTAAGG - Intergenic
1073709970 10:106025282-106025304 GCTAATTTCTGTGTTGTTTAAGG + Intergenic
1073741820 10:106416088-106416110 ACTGATAATTATTTTGTTTAAGG - Intergenic
1073820406 10:107256129-107256151 GCTGATAATTGTTTTGTTTAAGG - Intergenic
1073923480 10:108485980-108486002 GCTTATAATTGTTTTGTTTAAGG + Intergenic
1073960418 10:108920293-108920315 GCTGATGATTGTTTTGTTTGAGG - Intergenic
1074000310 10:109365566-109365588 GCTCATTACTGATTTGTTCAGGG + Intergenic
1074026508 10:109641343-109641365 GTTGATACCTGATTTGATTAAGG - Intergenic
1074037212 10:109752475-109752497 CCTGATAATTATTTTGTTTAAGG + Intergenic
1074295066 10:112178756-112178778 GGTGATAACTCTTTTGTGTCAGG - Intronic
1074985648 10:118657341-118657363 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1074986096 10:118661195-118661217 GCTGACAATTGTTTTGTTTCAGG + Intergenic
1075288579 10:121208795-121208817 GCTGACAACTTTTTTTTTTGGGG - Intergenic
1075493952 10:122901925-122901947 GCTGATAGTTGTCTTGTTTAAGG - Intergenic
1075946976 10:126441736-126441758 GCTGATAATTGTTTTATTTGAGG - Intronic
1075982584 10:126754176-126754198 GCTGTTAATTGTTTTGTATGAGG + Intergenic
1076376044 10:129985847-129985869 GCTGATAATTGTTTTGATTAAGG - Intergenic
1077964188 11:7110064-7110086 GCTGACAATTATTTTGTTTCAGG + Intergenic
1078288766 11:9984782-9984804 GCTGATAATTGTTTCGTTTGAGG - Intronic
1078706747 11:13750849-13750871 GCTGATAGTTGTTTTGTTTGAGG - Intergenic
1079207934 11:18433586-18433608 GCTGATAATTGTTTTGTTTGAGG + Intronic
1079255833 11:18829012-18829034 GCTGATAATTGCTTTGTATAAGG + Intergenic
1079270934 11:18985418-18985440 CCTGGTAATGGTTTTGTTTAAGG + Intergenic
1079464012 11:20711669-20711691 GCTGATAATTATTTTTTTTCAGG + Intronic
1079554162 11:21739176-21739198 GCTGGCATCTGTTTTGTTTCTGG + Intergenic
1079627357 11:22632338-22632360 GCTGATAGTTATTCTGTTTAAGG + Intronic
1079805859 11:24930511-24930533 GCTGGTAATTGTTTTGTTTAAGG + Intronic
1079952003 11:26817794-26817816 GCTGATAATTCTGTTGTTTGAGG + Intergenic
1080203184 11:29698086-29698108 GCTGACAATTGTTTTGTTTAAGG + Intergenic
1080324291 11:31051677-31051699 GCTAATAACTGTTTTGTTTGAGG - Intronic
1080402469 11:31948742-31948764 GCTGATAATTGTTTTGTTTGAGG - Intronic
1080672373 11:34393363-34393385 GCTGATAATTGTTTTATTTGAGG + Intergenic
1080923538 11:36732516-36732538 GCTGATAATTGTGTTGTTTAAGG - Intergenic
1081064666 11:38525645-38525667 GCTGACAGTTGTTCTGTTTAAGG - Intergenic
1081326521 11:41752525-41752547 ACTGATAATTGTTTTTTTTAAGG + Intergenic
1081425949 11:42926765-42926787 GCTGATATCTGTTTAGATTCTGG + Intergenic
1081952462 11:47056255-47056277 GCTGAAACCTGTGTTGTTCAAGG + Intronic
1082104098 11:48201235-48201257 GTTGATAATTATTTTGTTTAAGG - Intergenic
1082140346 11:48601977-48601999 GCTGATAATTGTTTTGTTTGGGG + Intergenic
1083064412 11:59909642-59909664 GCTGATGATTGTTTTGTTTGAGG + Intergenic
1083528380 11:63394513-63394535 GCTGATAATTGTTTTGTTTGAGG + Intronic
1084902793 11:72322159-72322181 GCTGACACCTGCTTTGTTTTCGG - Intronic
1085240365 11:75048734-75048756 GCTGATACTTGTTTTGTTTAAGG + Intergenic
1085748033 11:79131381-79131403 GCTGATAATTGTTTTGTTTGAGG - Intronic
1086217700 11:84403583-84403605 GCTTATAGCTGTTTTTTTTAGGG - Intronic
1086264754 11:84984333-84984355 GCTGATAATTGTTTTATTTAAGG - Intronic
1086297768 11:85389711-85389733 GCTGATAATTGTTTTGTTTGTGG - Intronic
1086300479 11:85421975-85421997 GCTGATTATTGTTTTATTTGAGG + Intronic
1086864368 11:91961467-91961489 GCTGATAATTATTTTGTTTAAGG - Intergenic
1086869205 11:92016756-92016778 GCTGATAATTATTTTCTTTAAGG + Intergenic
1086997735 11:93377892-93377914 GCTGATAATTGTTTCATTTAAGG + Intronic
1087469031 11:98547367-98547389 GCTGATAATTATTTTGTTTGAGG - Intergenic
1087602223 11:100330678-100330700 GGGGATAATTGTTTTGTTTAAGG - Intronic
1087610137 11:100424069-100424091 GCTGATAATTGTTTTGTTTAAGG - Intergenic
1087616096 11:100488119-100488141 GCTGATAATTGTTTTGTTTAAGG - Intergenic
1087631006 11:100650014-100650036 GCTGATAATTGTTTTGCTTAAGG - Intergenic
1087688777 11:101296100-101296122 GCTGATAATTTTTTTTTTTAAGG + Intergenic
1087804491 11:102540710-102540732 GCTGATAATTGTTTTGTTTAAGG - Intergenic
1087817398 11:102674793-102674815 GCCGATAATTGTTTTGTTTCAGG + Intergenic
1087907859 11:103720260-103720282 GCTGATCATTGTTTTGTTTAAGG - Intergenic
1088115635 11:106309581-106309603 GTTTATTACTGTTTTATTTATGG + Intergenic
1088137542 11:106576606-106576628 GCTGATAAATGTTTTGTTTGAGG + Intergenic
1088176149 11:107054809-107054831 GCTGACAATTATTTTGCTTAAGG - Intergenic
1088179633 11:107094112-107094134 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1088206595 11:107398886-107398908 GCTGATAAATGTTTTGTTTGAGG - Intronic
1088239806 11:107761433-107761455 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1088372294 11:109105153-109105175 GCTGATAATTGTTTTGTTGAAGG + Intergenic
1088387291 11:109273928-109273950 GCCAATAATTGTTTTGTTTAAGG + Intergenic
1088387885 11:109280244-109280266 GCTGATAATTGTTTTCTTTGAGG + Intergenic
1088413346 11:109561406-109561428 ACTGACAATTGTTCTGTTTAAGG + Intergenic
1088413624 11:109565640-109565662 GCTAATAATTGTTTTGTTTAAGG + Intergenic
1088951324 11:114573064-114573086 ACTGATAATTTTTTTGTTTAAGG - Intronic
1089826080 11:121279383-121279405 GCTAATAATTGTTTTGATTGAGG + Intergenic
1089837120 11:121380575-121380597 GCTGATAATTGTTCTGTTTAAGG - Intergenic
1089900265 11:121975128-121975150 GCTGATAATTGTTCTGTTTGAGG - Intergenic
1089952727 11:122545278-122545300 GCTGATAATTGTTTTGCTTGAGG + Intergenic
1090682846 11:129079450-129079472 GCTGATAATTGTTTTGTTTCAGG - Intronic
1090688396 11:129150569-129150591 GCTGACAAATATTTTGTTTAAGG - Intronic
1090756874 11:129799608-129799630 GCTGAAAATTATTTTGTTTCAGG - Intergenic
1090894842 11:130963011-130963033 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1091210300 11:133852761-133852783 GCTGATAATCGTTTTGTTTGAGG + Intergenic
1091525109 12:1292235-1292257 CCTGACAACTGGTTTGTTCAGGG + Intronic
1092303722 12:7278355-7278377 ACTGATAATTGTTTTGTTTGAGG + Intergenic
1092700142 12:11219293-11219315 GCTGATAATTGTTTTGTTTAAGG - Intergenic
1093001867 12:14006399-14006421 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1093010698 12:14103352-14103374 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1093105052 12:15076096-15076118 GCTGGTAATTGTTTTGTTTGAGG - Intergenic
1093172758 12:15877399-15877421 CCTGATAATTGTTTTGTTTGAGG - Intronic
1093266802 12:17013725-17013747 GCTGATAGTTATTCTGTTTAGGG + Intergenic
1093290940 12:17321310-17321332 GCTGATAATTGTTTTCCTTAAGG + Intergenic
1093389769 12:18603723-18603745 GCTGATAATTGTTTTGTTTTAGG - Intronic
1093409049 12:18843549-18843571 GCTGACAATTGTTCTGTTTGAGG + Intergenic
1093488541 12:19679943-19679965 GCTGATAATTGTTTCGTTTGAGG + Intronic
1093604341 12:21072329-21072351 GCCGATAACTTTCTTGTTTAAGG + Intronic
1093948538 12:25137235-25137257 GCTGATAATTATTTTGTTTAAGG - Intronic
1093963926 12:25304882-25304904 GCTGATAATTATTTTGTTTAAGG - Intergenic
1093991596 12:25594415-25594437 GCTGATAATTGTTTTGTTTGAGG - Intronic
1094263279 12:28526393-28526415 GCTGATAATTGTTTTGTTTGAGG + Intronic
1094297310 12:28922246-28922268 GCTAATAATTGTTTTGTTTAAGG - Intergenic
1094362293 12:29642444-29642466 ACTGATAATTGTTTTGTTTGAGG - Intronic
1094447193 12:30544810-30544832 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1094717908 12:33031968-33031990 GCTGACAATTGTTTTGTTTGAGG + Intergenic
1094721854 12:33073966-33073988 ACTGATAATTGTTTTGTTTAAGG + Intergenic
1094802292 12:34050221-34050243 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1094808718 12:34116340-34116362 GCTGATGATTGTTTTGTTTGAGG - Intergenic
1095118071 12:38380436-38380458 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1095176446 12:39097314-39097336 TCTTATAATTGTTTTGTTTAAGG - Intergenic
1095178557 12:39121334-39121356 GCTGATAATTCTTTTGTTTAAGG + Intergenic
1095369417 12:41448919-41448941 GCCAATAAATGTTTTGTTTTTGG - Intronic
1095486074 12:42686093-42686115 TCTTAAGACTGTTTTGTTTAGGG + Intergenic
1095665346 12:44790328-44790350 GCTGATAATTGTTTTGTTTGAGG - Intronic
1095732918 12:45524315-45524337 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1095892985 12:47251774-47251796 GTTGATAATTGTTTTGTTTGAGG - Intergenic
1095932230 12:47638504-47638526 GTTGATAATTGTTTTGTTTGAGG - Intergenic
1096341708 12:50806378-50806400 GCTGATAACTGTCATCCTTATGG - Intronic
1096348056 12:50867827-50867849 GGCGATAATTGTTTTGTTTGAGG - Intronic
1096436488 12:51594747-51594769 ACAGATAATTGTTTTGCTTATGG - Intronic
1096437900 12:51610682-51610704 GCTGATAATTGTTTTGTTTGAGG + Intronic
1096562506 12:52446990-52447012 GCTGATAACTGTTGACTTGATGG + Exonic
1096956615 12:55532485-55532507 GCTGATAATTATTTTGTTTAAGG - Intergenic
1096957009 12:55536202-55536224 GCTCACAATTGTTTTGTTTGAGG - Intergenic
1097295667 12:57959593-57959615 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1097385793 12:58949020-58949042 GCTGATAATTGCTTTGTTGGAGG + Intergenic
1097547736 12:61025200-61025222 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1097589243 12:61553389-61553411 GCTGATGTCTGTTTTGTAAAGGG - Intergenic
1097676309 12:62605788-62605810 GCAGTTAACTTTTTTGTTAAAGG + Intergenic
1097760773 12:63461189-63461211 GCTGATAATTGTTTTATTTGAGG - Intergenic
1097906805 12:64928970-64928992 GCTGACAATTATTTTGCTTAAGG + Intergenic
1097959820 12:65521499-65521521 GCTGATAGCTGTTTGGCTTCTGG + Intergenic
1098223854 12:68300039-68300061 GCTGATAGGTGTTCTGTTTAAGG - Intronic
1098518789 12:71411056-71411078 GCTGACAATTGTTTTGCTTCAGG - Intronic
1098654565 12:73011842-73011864 GCTGACAATTATTTCGTTTATGG + Intergenic
1098852412 12:75612454-75612476 GCTGGTAATTGTTTTGTTTAAGG - Intergenic
1098960753 12:76737780-76737802 GTTGATAATTGTTTTGTTTGAGG + Intergenic
1099042147 12:77669001-77669023 GCTGATAATTGTTTCGTTTAAGG - Intergenic
1099332334 12:81305343-81305365 GCTAATAAATGTTTACTTTAAGG - Intronic
1099472876 12:83073266-83073288 GCTGATAATTGTTTTGTTTGAGG + Intronic
1099476983 12:83120441-83120463 GCTGAGAATTGTTTTGTTTGAGG + Intronic
1099777259 12:87149957-87149979 GCTGATACTGGTTTTGTTTGAGG + Intergenic
1099844602 12:88013833-88013855 GCTGAGAACTGTTTGGTTTTTGG + Intronic
1100203421 12:92324034-92324056 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1100669364 12:96794025-96794047 GCTGACAATTGTTTTGTTTAAGG + Intronic
1100697078 12:97106615-97106637 GCTGGTAATTGGTTTGTTTGAGG + Intergenic
1100706474 12:97205207-97205229 GCTGATAATTGTTTTGTTTAAGG - Intergenic
1100918707 12:99457111-99457133 GCTGATAATTGTTTTATTTAAGG - Intronic
1100951484 12:99854749-99854771 GCTGTTAATTGTTTTGATTAAGG - Intronic
1100970495 12:100064640-100064662 GCTGATAATTGTTTTGTTTGAGG - Intronic
1101261972 12:103042240-103042262 GCTGATAACAGCCTTATTTAAGG + Intergenic
1101290557 12:103363200-103363222 GCTGATAATTGTTTTGTTTAGGG - Intronic
1101298026 12:103446216-103446238 GCTGATAATTGCTTTGTTTAAGG - Intronic
1101635099 12:106534092-106534114 GCTGATAATCGTTTTGTTTGAGG + Intronic
1102611305 12:114114832-114114854 GCTGACAATTATTTTGTTTCAGG + Intergenic
1102916559 12:116758648-116758670 GCTAATCATTGTTTTGTTTGAGG + Intronic
1103278743 12:119736492-119736514 GCTGATAACCTTTTAGTGTATGG + Intronic
1103649925 12:122423878-122423900 GCTGAAGACTGTTTAGATTAGGG - Intergenic
1103760692 12:123248253-123248275 GCTGATAATTGTTTTGTTTGAGG + Intronic
1104504329 12:129317431-129317453 GCTGATAATTATTTTGTTTGAGG + Intronic
1105314604 13:19245665-19245687 GCTGATAATTGTTTTGTTTAAGG - Intergenic
1105524669 13:21166017-21166039 TCTGATAACTTTTTTTTTTTTGG + Intronic
1105598699 13:21865763-21865785 GCTGATAATTGTCTTGTTTAAGG + Intergenic
1105990270 13:25613726-25613748 ACTGATAATTGTCTTGTTTAAGG + Intronic
1106205791 13:27593081-27593103 GGTGAAAAATGTTTTGTTAATGG - Intronic
1106337025 13:28792725-28792747 GATGATAACTGTATTATTTAGGG + Intergenic
1106392077 13:29344946-29344968 GCTGACAATTGTTTTGTTTAAGG + Intronic
1106977974 13:35245574-35245596 GCTGATAATTGTTTTGTTTAAGG + Intronic
1107218977 13:37957389-37957411 GCTGCTATCTGTTTTGTATTAGG + Intergenic
1107426644 13:40300638-40300660 GCTGGTAATTGCTTTGTTTGAGG + Intergenic
1107701880 13:43056897-43056919 TGTGAAAATTGTTTTGTTTAAGG + Intronic
1107738456 13:43423283-43423305 GGTGATCACTTTTTTTTTTATGG - Intronic
1108189110 13:47918910-47918932 GCTGGAAATTGTTATGTTTAAGG - Intergenic
1108298563 13:49051461-49051483 ACTGATAATTGTTTTGTTTAAGG + Intronic
1108469611 13:50754978-50755000 GCTGAAAATTGTTTTGCTTGAGG + Intronic
1108791624 13:53975348-53975370 GCTGACAATTATTCTGTTTAAGG - Intergenic
1108817255 13:54306749-54306771 GCTGATAATTGTCTTGTTTGAGG - Intergenic
1108825735 13:54409653-54409675 GCTGATAATTGTCTTGTTTGAGG - Intergenic
1108831817 13:54488426-54488448 GCTGATAATTCTTTCATTTAAGG - Intergenic
1109125276 13:58509808-58509830 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1109201178 13:59433481-59433503 GTTGATAATTGTTGTGTTTAAGG + Intergenic
1109213411 13:59561680-59561702 GCTGATAATTGCTTTCTTTGAGG + Intergenic
1109484729 13:63003407-63003429 TCTGGTAATTGTTCTGTTTAAGG - Intergenic
1109508250 13:63335519-63335541 GCTGATAATTGTTTTGTTTTAGG + Intergenic
1109534500 13:63698931-63698953 GCTGATAATTATTTTGTTTTAGG + Intergenic
1109662962 13:65489706-65489728 CCTGTTAGCTGTTTTGTTTGAGG + Intergenic
1109723488 13:66308008-66308030 GTTGACATCTGTTTTGTTCAAGG - Intronic
1109824388 13:67698326-67698348 GCAGATAATTGTTTCGTTTAAGG - Intergenic
1109945440 13:69425482-69425504 GCTGACAATTGTTTTGTTTAAGG - Intergenic
1109975801 13:69829802-69829824 GTCGATAATTGTTTTGTTTAAGG - Intronic
1110182003 13:72627844-72627866 GCTGATAATTGTTTTGTTTAAGG - Intergenic
1110204578 13:72897153-72897175 GCTTATAATTGTTTTGTTTGAGG - Intronic
1110214289 13:73009273-73009295 GCTGATAAATGTTTTATACAGGG + Intronic
1110562044 13:76919456-76919478 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1110627737 13:77669916-77669938 GCTGATAATTGTTGTATTTGAGG - Intergenic
1110748240 13:79080924-79080946 CCTGATAATGGTTTTGTTTGAGG - Intergenic
1110793494 13:79611532-79611554 GATGATAATTGTTTTGTCTGAGG + Intergenic
1110852458 13:80261298-80261320 GCTGATAGTTGCTTTGTTTGAGG + Intergenic
1110881722 13:80579501-80579523 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1110888047 13:80663541-80663563 GCTGACAATTATTTTGTTTATGG + Intergenic
1111148642 13:84218256-84218278 GCTGGTAATCGTTTTGTTTTAGG - Intergenic
1111160784 13:84392598-84392620 GCTAATAATTGTTTTGTTTAAGG + Intergenic
1111165591 13:84454142-84454164 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1111225760 13:85268328-85268350 AATGATAATTGTTTTGATTAAGG - Intergenic
1111270236 13:85872288-85872310 GGTGATAACTTCTTTTTTTAAGG - Intergenic
1111283154 13:86053079-86053101 GCTGATAATTGTTTTGTTTAAGG - Intergenic
1111988613 13:95091498-95091520 GCTGATCATTGTTTTGTTTGAGG - Intronic
1112738255 13:102444848-102444870 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1112747478 13:102542902-102542924 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1112945494 13:104921675-104921697 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1112995133 13:105565209-105565231 GCAGATTACTTTTTTATTTATGG - Intergenic
1113240458 13:108330664-108330686 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1113269779 13:108661072-108661094 GCTGATAATTGTTTTGCTTGAGG + Intronic
1113526873 13:110986275-110986297 GCTGAGAGCTGTTTTTTTTAAGG - Intergenic
1113534865 13:111058114-111058136 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1113637990 13:111935148-111935170 GCCAATAAGTGTTTTGTTTAAGG + Intergenic
1113845464 13:113387103-113387125 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1114030620 14:18576664-18576686 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1114337112 14:21701334-21701356 GCTGATAATTGTTTTGTTTAAGG - Intergenic
1114692152 14:24594056-24594078 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1114830951 14:26140822-26140844 GTTGATACCTGTTTTATTGAGGG - Intergenic
1115299429 14:31867002-31867024 GCTGATAATTGTTTTGTTCGAGG - Intergenic
1115350470 14:32389634-32389656 GCTGATAATTGTTTTGTCTGAGG + Intronic
1115393057 14:32875930-32875952 GCTGATAATTGTTGTGTTTAAGG + Intergenic
1115458295 14:33630834-33630856 GCTGATCTCTGCTTTGTTTGAGG - Intronic
1115527065 14:34292020-34292042 GCTGATAATTGTTTTGTTTGAGG + Intronic
1115680483 14:35732087-35732109 GCTGATAATTGTTTTGTTTGAGG - Intronic
1115835315 14:37396263-37396285 GCTGATAATTGTTTTGTTTGAGG + Intronic
1115885441 14:37966601-37966623 GCTGATAATTGATCTGTTCAGGG + Intronic
1115937996 14:38576832-38576854 GCCAATAATTGTTTTGTTTAAGG + Intergenic
1115969966 14:38933905-38933927 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1115997159 14:39206082-39206104 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1116048871 14:39779793-39779815 ACTGATAATTCTTTTGTTTGAGG + Intergenic
1116064046 14:39959802-39959824 GCTGATAATTGTTTTGTTTATGG - Intergenic
1116088828 14:40278000-40278022 GCTGATATTTGCTTTGTTTGAGG + Intergenic
1116324586 14:43515894-43515916 GCTGATAATTATTTTGTTTAAGG - Intergenic
1116335673 14:43652960-43652982 GCTGCTAATTGTTTTGTTTGAGG - Intergenic
1116668877 14:47815947-47815969 GCTGATAATTGTCTTGTTTAAGG + Intergenic
1116668878 14:47815991-47816013 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1116732162 14:48637511-48637533 ACTGATTATTGTTTTGTTTGAGG - Intergenic
1116964242 14:50998087-50998109 GCTGACTCCTGTTTTGTTGAAGG + Exonic
1117103631 14:52376935-52376957 GCTAATAATTGTTTTGTTTAGGG + Intergenic
1117182380 14:53204032-53204054 GCTGATAATTGTTTTGTTTAAGG - Intergenic
1117271531 14:54148437-54148459 GCTGATCATTGTTTTGTTTAAGG - Intergenic
1117509959 14:56441401-56441423 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1117639999 14:57787611-57787633 GCTGATAATTGTTTTGTTTGAGG - Intronic
1117655249 14:57949815-57949837 GCTGACAATTATTTTGTTTAAGG + Intronic
1117768696 14:59109518-59109540 GCTGATAATTGTTTTGTCTGAGG - Intergenic
1118118594 14:62810136-62810158 ATTGATAAGTGTTTAGTTTAAGG - Intronic
1118140035 14:63070913-63070935 GCTGATAATTATTTTGTTTAAGG + Intronic
1118162469 14:63303515-63303537 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1118531945 14:66716803-66716825 GCTGAGAATTGTTTTGTTTGAGG + Intronic
1118671177 14:68129130-68129152 GATGTTAACTTATTTGTTTAAGG + Intronic
1119098639 14:71857782-71857804 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1119489105 14:75014902-75014924 GCTGTTAACTGGTTTGCTGAAGG - Exonic
1119582504 14:75799755-75799777 GCTGATAATTGTTTTGTTTAAGG + Intronic
1120400177 14:84021556-84021578 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1120450761 14:84664521-84664543 GGTGATAATTGTTTTGTTTAAGG + Intergenic
1120489755 14:85162348-85162370 GTTGATAATTGTTTTGTTTGAGG - Intergenic
1120736193 14:88056042-88056064 GCAGATAATTGTTTTGTTTAAGG + Intergenic
1120777152 14:88450585-88450607 GCTGATAATTGCTTTGTTTAAGG + Intronic
1120785434 14:88530129-88530151 GCTGATAATTGTTTTGTTTAAGG - Intronic
1121460036 14:94067687-94067709 GCTGAAGATTGTTTTGTTTGAGG - Intronic
1121503303 14:94457311-94457333 GCCGATAATTGTTTTGTTTAAGG + Intergenic
1121575612 14:94983049-94983071 GCTGATAATTGTTTTGTTTAAGG - Intergenic
1121848271 14:97195017-97195039 GCTGATAATTGTTTTGCTTAAGG + Intergenic
1121996065 14:98604020-98604042 GCTGAATACTGTTTTTTTTGCGG + Intergenic
1123104059 14:105829208-105829230 GCTGATAATTGTTCTGTTGGAGG - Intergenic
1124380901 15:29164018-29164040 GCTGATAATCGTTTTGTTTGAGG - Intronic
1124386472 15:29212154-29212176 GCTGGTTACTGTTCTGTTCAGGG + Intronic
1124505190 15:30266451-30266473 GCTGATAATTGTTTTGTTCAAGG - Intergenic
1124738362 15:32272184-32272206 GCTGATAATTGTTTTGTTCAAGG + Intergenic
1125055773 15:35357670-35357692 GCTGATAACTGTTTTGTTTGAGG + Intronic
1125269237 15:37920252-37920274 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1126190730 15:45875179-45875201 GCTGATAATTGTTTTGTTTAAGG - Intergenic
1126460600 15:48911885-48911907 GCTGATAATTGTTTTGTTTGAGG + Intronic
1126463037 15:48933982-48934004 GATTATGACTGTTTTCTTTAAGG - Intronic
1126521215 15:49596313-49596335 ACTGATAATAATTTTGTTTAAGG - Intronic
1126572887 15:50170375-50170397 GCTGATAATTGTTTTGTTTGAGG - Intronic
1126591995 15:50349356-50349378 GCTATTAACTGTTATGTTTCAGG + Intronic
1126977463 15:54199543-54199565 GCTTATAATTGTTTTTTTTAAGG - Intronic
1127008034 15:54593096-54593118 GCTAATAATTGTTTTATTTGAGG + Intronic
1127090213 15:55459208-55459230 GCGGATAATTATTTTGTTTAAGG - Intronic
1127573802 15:60270965-60270987 GCTGATCATTGTTTTGTTTAAGG + Intergenic
1127694499 15:61432056-61432078 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1127742087 15:61919632-61919654 GCTGAAAACAGTTTTGCTTGGGG + Intronic
1128238912 15:66086513-66086535 ACTGATAATTGTTTTGTCTGAGG - Intronic
1128415189 15:67438251-67438273 GCTGATAATTGTTTTGTTTGAGG - Intronic
1129097426 15:73224089-73224111 GCTGATAATTGTTATGTTTGAGG + Intronic
1129631872 15:77268866-77268888 GCTGATAATTATTTTGTTTAAGG - Intronic
1130749596 15:86696887-86696909 GTTGATAATTGTTTTGTTTAAGG + Intronic
1130779735 15:87022811-87022833 GCTGATAGTTGTTTTGTTTGAGG - Intronic
1131326677 15:91454808-91454830 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1131369919 15:91871787-91871809 GCTGATAAGTGTTTTATTTCAGG + Intronic
1131413945 15:92235035-92235057 GCTGACAATTATTCTGTTTAAGG - Intergenic
1131711093 15:95057618-95057640 GCTAATAATTATTTTGTTTAAGG + Intergenic
1131869948 15:96753506-96753528 GCTGGTAATCTTTTTGTTTAAGG - Intergenic
1132210119 15:100015655-100015677 GCTGATAATTGTTTTGTTTGAGG + Intronic
1132253884 15:100356956-100356978 ATTGATAATTGTTTTGTTTAAGG - Intergenic
1132412679 15:101596154-101596176 GCTGATAATTTTTTTGTTTAAGG + Intergenic
1134323768 16:13188132-13188154 GTGGGTAAGTGTTTTGTTTATGG - Intronic
1134805842 16:17124405-17124427 GCTGGTAACTGTTTTGTTTAAGG + Intronic
1135093763 16:19544604-19544626 GCAGATAACTATTTTATATAAGG + Intronic
1135690292 16:24531402-24531424 GCTGAGTTCAGTTTTGTTTATGG - Intergenic
1135851884 16:25971254-25971276 GCAGGTGACTGTTTTCTTTATGG - Intronic
1135901812 16:26466589-26466611 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1136735805 16:32466527-32466549 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1138192280 16:55023659-55023681 GCTGACAATTGATTTGTTTAAGG - Intergenic
1138259917 16:55610445-55610467 GCTGATTATTGACTTGTTTAGGG + Intergenic
1139485496 16:67254312-67254334 GCTGCTAACTATTTTTATTAGGG - Intronic
1139987745 16:70914426-70914448 GCTGATACTTCTTTTGTTTGAGG + Intronic
1140530933 16:75665337-75665359 GCTGATAATTGTTTTGTTTAAGG - Intronic
1140548140 16:75832420-75832442 GCTGATAATTGGTTGGTTTAAGG + Intergenic
1203017270 16_KI270728v1_random:363047-363069 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1203035605 16_KI270728v1_random:636205-636227 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1142840995 17:2630398-2630420 GCTGATAATTGTTTTGTTTGAGG + Intronic
1142910624 17:3087794-3087816 GCTGGTAATTGTTTTGTTTAAGG + Intergenic
1143226751 17:5311318-5311340 GCATATAAATGTTTTCTTTACGG + Intronic
1143762578 17:9115928-9115950 GCTCATGTTTGTTTTGTTTATGG - Intronic
1143990999 17:10961274-10961296 GCTGATAATTGTTTTATTTGAGG - Intergenic
1144278195 17:13697801-13697823 GTTGATAATTGTTTTGTTTAAGG + Intergenic
1146496778 17:33329706-33329728 GAGGATAAGTGATTTGTTTAAGG - Intronic
1146583566 17:34061200-34061222 GCTGATAATGGTTTTGTTTGAGG - Intronic
1146612956 17:34324401-34324423 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1146746488 17:35334932-35334954 GGTAATAATTGTTTTGTTCAAGG + Intergenic
1147463018 17:40587713-40587735 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1148400411 17:47355167-47355189 GCTGATAATTGTTTTGTTTAAGG + Intronic
1149122227 17:53183663-53183685 GCTGATCATTGTTTTGTTTAAGG + Intergenic
1149221563 17:54420032-54420054 GCTGGTAATTGTTTTGTTTAAGG - Intergenic
1150528822 17:65955216-65955238 GCTAATAATTGTTTTGTTTAAGG - Intronic
1150539211 17:66078913-66078935 GCTGATAATTGTTTTGTTTGAGG + Intronic
1150818599 17:68416306-68416328 GCTGATAATTGTTTTGATGGAGG + Intronic
1151048558 17:70949300-70949322 TCTGACAATTGTTTTGTTTGAGG - Intergenic
1152953886 18:18988-19010 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1153065627 18:1041232-1041254 GCTGATAATTGTTTCATTTGAGG - Intergenic
1153071763 18:1114487-1114509 GTTGATAATTGTTTTTTTTAAGG + Intergenic
1153079748 18:1209039-1209061 GCTGATAATTGTTTTTTTAAAGG + Intergenic
1153164443 18:2245813-2245835 GCTGATAATTGTTTCATTTGAGG - Intergenic
1153396226 18:4624479-4624501 ACTGATAATTGTTTTCTTTAAGG + Intergenic
1153400645 18:4680455-4680477 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1153425215 18:4955233-4955255 GCTGATAATTATTTTGTTTAAGG - Intergenic
1153814328 18:8779782-8779804 GCTGACAGCTTTTTTCTTTAAGG + Intronic
1153828928 18:8902538-8902560 GCTGGCAATTGTTTTGTTTGAGG - Intergenic
1153869598 18:9305183-9305205 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1153965760 18:10180730-10180752 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1154090170 18:11350923-11350945 GCTGATAATTGTTTTGTTTAAGG - Intergenic
1154298046 18:13167383-13167405 GGTGATAATTCTTTTGTTTAAGG - Intergenic
1155573659 18:27222446-27222468 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1155886924 18:31219144-31219166 GCTGATAGTTATTTTGTTTGAGG - Intergenic
1156011149 18:32499668-32499690 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1156344596 18:36245415-36245437 GCTGATAATTATTTTGTTTAAGG + Intronic
1156642675 18:39121065-39121087 GCTGATAATTATTTTGTTTAAGG - Intergenic
1156893199 18:42214053-42214075 GCTGATCATTGTTTTGTTTAAGG + Intergenic
1157218761 18:45808580-45808602 GTTGATAATTGTTTTGTTTGAGG - Intergenic
1157507672 18:48240548-48240570 GCTGATAATTGTTTTGTTTAAGG - Intronic
1157703119 18:49777827-49777849 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1158002793 18:52638019-52638041 CCTGATAATTGTTTTGTTTGAGG - Intronic
1158097810 18:53794195-53794217 ACTGATAATTGTTTTGTTTAAGG - Intergenic
1158377407 18:56886330-56886352 GCTGATAATTGTTTTGGCTAAGG - Intronic
1158829996 18:61265986-61266008 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1159267112 18:66096459-66096481 GCTTATAAATCTTTTGTTAAAGG + Intergenic
1159612741 18:70544860-70544882 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1159906762 18:74099277-74099299 GCTGATAGTTGTTTTGTTTAAGG - Intronic
1159997181 18:74977304-74977326 GCTGATGACTGGTTGGTTTTAGG - Intronic
1160059001 18:75512528-75512550 GCTGACAATTATTTTGTTTAAGG - Intergenic
1160267450 18:77352560-77352582 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1163886393 19:19969208-19969230 GCTGATACTTGTTCTGTTTAAGG + Intergenic
1163888036 19:19985876-19985898 GCTGATACTTGTTCTGTTTAAGG - Intergenic
1163949939 19:20574784-20574806 GCTGATACTTGTCTTGTTTAAGG + Intronic
1163968066 19:20766604-20766626 GCTGATGCTTGTCTTGTTTAAGG - Intronic
1164010496 19:21199315-21199337 GCAAATAAGTGTTTTGTTGATGG + Intergenic
1164251879 19:23484521-23484543 GCACATAATTGTTTTGTTTGAGG - Intergenic
1164263414 19:23590106-23590128 GCTGATAATTATTTTGTTTAAGG - Intronic
1164273675 19:23697808-23697830 GCTAAAAATTGTGTTGTTTACGG + Intergenic
1164320017 19:24136083-24136105 ACTGATAATTGTTTTGTTTGAGG + Intergenic
1166604082 19:44125323-44125345 GCTGATAATTGTTTTGTTTAAGG + Intronic
1166874256 19:45887468-45887490 CCTGATAAATCTTTTTTTTAAGG - Intergenic
1166899801 19:46051022-46051044 GCTGATAATTGCGTTGTTTAAGG - Intronic
1167218487 19:48181453-48181475 GCTGATTAGTGTTTTATTTTAGG + Intronic
1167669607 19:50842614-50842636 GCTGATAATTGTTTTGTATAAGG + Intergenic
1168395912 19:56048510-56048532 GCTGATACTTGTTTTGTTCAAGG + Intronic
1168458248 19:56532415-56532437 GGTGATAATTGTTTTGTTTGAGG + Intergenic
1168535503 19:57165842-57165864 TATCTTAACTGTTTTGTTTATGG - Intronic
1168693447 19:58391624-58391646 GCTGAGAACTTTTTTGTTTTTGG - Intronic
924992683 2:327325-327347 GTTGATAATTGTTTTGTTTAAGG + Intergenic
925441754 2:3893896-3893918 GCTGATACTTGTTTTGTTTAAGG + Intergenic
925647234 2:6048389-6048411 GCTCATTACTGGTTTGTTCAGGG - Intergenic
925652118 2:6102403-6102425 GATGATAATTGTTTTGTTTAAGG + Intergenic
925795526 2:7538271-7538293 GCTGATAATTGTTTTGTTTAAGG + Intergenic
926556042 2:14359226-14359248 GCTGATAATTGTTTTGTTTAAGG - Intergenic
926560349 2:14409857-14409879 GCTGATAATTGTTTTGTTTGAGG - Intergenic
926915823 2:17891714-17891736 GCTGATAATTGTTTTGTTTGAGG + Intronic
927069781 2:19515746-19515768 GCTGATAATTATTTTATTTAAGG + Intergenic
927071752 2:19537804-19537826 GCTGAGAATTGTTTTGTTTAAGG - Intergenic
927080122 2:19618936-19618958 GCTGATAATTGCTTCCTTTAAGG - Intergenic
927176565 2:20413665-20413687 GCTGATAATTGTTTTGTTTAAGG + Intergenic
927328174 2:21831127-21831149 GCTGATAATTGTTTCGTTTGAGG + Intergenic
927363324 2:22263410-22263432 GCTGATCATTGTTTTGTTTGAGG + Intergenic
928473132 2:31593897-31593919 GCTGATAGTTATTTTGTTTAAGG - Intergenic
928772348 2:34718256-34718278 GCTGATAATTGTTTTGTTTGAGG + Intergenic
928855744 2:35800749-35800771 GCTGATAAATGCTATGTTTAGGG + Intergenic
928856138 2:35804509-35804531 GCTGATAATTGTTTTGTTTGAGG - Intergenic
929010110 2:37433674-37433696 GCTGATAATTGTTTTGTTTGAGG + Intergenic
929197265 2:39197690-39197712 GCTGATAATTGTTTTGTTTAAGG - Intronic
930423122 2:51178351-51178373 ACTGATAGTTGTTTTGTTCAAGG - Intergenic
930486343 2:52016403-52016425 GCTGATAATTGTTTCGTTTGAGG + Intergenic
930574139 2:53125883-53125905 GCTGATAATTGTTTTATTCAAGG + Intergenic
931136154 2:59403495-59403517 GCTGATAATTGTTTTGTTTGTGG - Intergenic
931524994 2:63143728-63143750 GCTGATAATTGTTTTGTTTGAGG + Intronic
931535980 2:63277079-63277101 GCTGATAATTGCTTTGTTTAAGG - Intronic
931548042 2:63410220-63410242 ACTGATAATTGTTTTGTTCAAGG - Intronic
931572607 2:63684573-63684595 ACTGATGACAGTTTTGTTCAAGG - Intronic
931834799 2:66087139-66087161 GCTGATAATTGTTTTGTTTAAGG - Intergenic
932100440 2:68894896-68894918 GCTGATGATTGTTTTGTTTGAGG + Intergenic
932270476 2:70404413-70404435 GCTGATAATCGTTTTGTTTGAGG - Intergenic
932384734 2:71321952-71321974 GCTGATAATTGTTTTGTTTGAGG + Intronic
932954477 2:76335952-76335974 GCTGGTAATTGTTTTGTTTGAGG + Intergenic
933086155 2:78056998-78057020 GCTGACAATTATTTTGTGTAAGG + Intergenic
933253242 2:80051955-80051977 GTTGAACACAGTTTTGTTTAGGG - Intronic
933340807 2:81024124-81024146 GCTGACAATTTTTTTGTTTAAGG + Intergenic
933382236 2:81563657-81563679 GCTAATAATTGTTTTGTTTAAGG + Intergenic
933398078 2:81756658-81756680 GCTCATCATTATTTTGTTTAAGG - Intergenic
933433311 2:82213344-82213366 GTTGACAATTGTTTTGTTTGAGG + Intergenic
933604297 2:84365652-84365674 GCTCATTATTGTTTTGTTCAAGG - Intergenic
934111234 2:88745566-88745588 GCTGATAATTAATTTGTTTAAGG + Intronic
934177573 2:89590128-89590150 GCTGATAATTGTTTTGTTTGAGG + Intergenic
934186970 2:89755633-89755655 GCTGATAATTGTTTTGTTTGAGG + Intergenic
934287870 2:91664429-91664451 GCTGATAATTGTTTTGTTTGAGG + Intergenic
934310019 2:91853536-91853558 GCTGATAATTGTTTTGTTTGAGG - Intergenic
935002871 2:99038010-99038032 GCTGATAATTGTTTTGTTTAAGG - Intronic
935007288 2:99091126-99091148 GCTGACAATTGTTTTGTTTAAGG - Intronic
935265291 2:101388143-101388165 GTTGTTTACTGTATTGTTTAGGG + Intergenic
935370235 2:102338071-102338093 GCTGATAAAAATTCTGTTTATGG + Intronic
935691546 2:105736433-105736455 GATCATAACTGTGATGTTTAAGG + Intergenic
936164618 2:110108893-110108915 GCTGATAATTGTTTTGTTTGAGG - Intronic
936555077 2:113489209-113489231 GCTGATAATTGTTTTGTTTGAGG - Intronic
936841534 2:116775513-116775535 GATAATTACTGCTTTGTTTATGG - Intergenic
936911169 2:117595524-117595546 GCTGATAATTGTTTTGTTTGAGG + Intergenic
937058037 2:118955805-118955827 GCTGATAATTGTTTTGCTTGAGG - Intronic
937069076 2:119048945-119048967 GCTGATAATTGTTTTGTGTGAGG + Intergenic
937461343 2:122090296-122090318 GCTGACAATTACTTTGTTTAAGG + Intergenic
937529436 2:122810051-122810073 GCTGAATAGTGTTTTGTTTGAGG - Intergenic
937561446 2:123229833-123229855 GCTAATAATTGTTTTGTTTATGG + Intergenic
937572618 2:123382379-123382401 GCTGATAATCTTTTTGTTTAAGG - Intergenic
937663186 2:124453735-124453757 GCTGATAATTGTTTTGTTTGTGG - Intronic
937716167 2:125036104-125036126 GCTGTTAATTGTTTTGTTTAAGG + Intergenic
937722889 2:125124839-125124861 GCTGATAATTGTTTTATTTAAGG + Intergenic
937767461 2:125678762-125678784 GCTGAAAATTGTTTTGTTTGAGG + Intergenic
937798819 2:126057829-126057851 ACTGATAATTGTTTTGCTTAAGG + Intergenic
937828792 2:126397987-126398009 GCCGATAATTGTTTTGTTTAAGG + Intergenic
937971903 2:127556677-127556699 GCTGATAATTGTTTTGTTTAAGG + Intronic
938037904 2:128051812-128051834 GCTGATGATTATTTTGTTTGAGG + Intergenic
938175417 2:129122624-129122646 GTTGATAATTGTTTTGTTTAAGG + Intergenic
938497588 2:131809103-131809125 GCTGATAATTGTTTTGTTTGAGG - Intergenic
938599603 2:132823403-132823425 GCTGACAATTATTTTGTTTCAGG - Intronic
939149667 2:138457854-138457876 GCTGAAAATTGTTTTGTTCAAGG - Intergenic
939219504 2:139283117-139283139 GTTGACAATAGTTTTGTTTAAGG - Intergenic
939240109 2:139547282-139547304 GCTAATAATTGTTTTGTTTAAGG + Intergenic
939245609 2:139619886-139619908 GCTGAAAATTGTTTTGGTTAAGG + Intergenic
939476771 2:142696715-142696737 GCTGACCATTATTTTGTTTATGG - Intergenic
940034533 2:149300356-149300378 GGTGATAATTGTTTTGTTTGAGG + Intergenic
940156975 2:150667357-150667379 GCTGCTAATTGTTTTGTTTGAGG - Intergenic
940217794 2:151317834-151317856 GCTGATAATTGTTTTATTTAAGG - Intergenic
940415614 2:153416596-153416618 GCTGATTACCATTCTGTTTATGG + Intergenic
940423526 2:153506628-153506650 GCTGATAATTGTTTTGTTTAAGG + Intergenic
940524258 2:154792037-154792059 TCTGAAAACTGTTTTGTGTTTGG - Intronic
940618512 2:156082421-156082443 GCTGATAATTGTTTTGTTTGAGG + Intergenic
940630487 2:156231562-156231584 GCTGAAAATTATTTTGCTTAAGG - Intergenic
940709230 2:157142631-157142653 GCTGATAATTGTTTTGTTTGAGG + Intergenic
940762520 2:157752647-157752669 GCTCATAATTGTTTTGTTTAAGG - Intronic
940796649 2:158087781-158087803 GCTGATAATTGTTTTGTTTAAGG + Intronic
941109798 2:161406984-161407006 CCTAATAACTGTTTTGTACATGG + Intronic
941358063 2:164516583-164516605 GCTGATAATTATTTTGTTTAAGG - Intronic
941593687 2:167450483-167450505 GCTGATAACTGTTTTGTTTAAGG + Intergenic
941627611 2:167846451-167846473 GCTGATAATTGTTTTGTTTGAGG - Intergenic
941679792 2:168384921-168384943 GCTGATAATTGTTTTGTTTGAGG - Intergenic
941702276 2:168616072-168616094 GCTGATAATTGTTTTGTTTGAGG - Intronic
942154559 2:173114691-173114713 GCTGATAATTGTTTTGTTTAAGG + Intronic
942469900 2:176249485-176249507 GCTGATAATTGTTTTGTTTGAGG + Intergenic
942726211 2:179010502-179010524 GCTGATAATTGTTTTGTGTGAGG - Intronic
942743795 2:179208575-179208597 GCTGATAATTATTTTGATTAAGG - Intronic
942937392 2:181574675-181574697 GCTGACAACCGTTTCTTTTACGG + Intronic
943129850 2:183841394-183841416 GCTTGTAATTGTTTTGTTTGTGG - Intergenic
943149837 2:184098142-184098164 GCTGACAATTTTTTTGTTTAAGG + Intergenic
943449208 2:188027300-188027322 GCTGATAATTGTATTGTTTAAGG + Intergenic
943891116 2:193288862-193288884 GCTGATAAGTATTTTATTTGAGG + Intergenic
943909463 2:193544098-193544120 GATGATAATTGTTTTGTTTAAGG - Intergenic
944148289 2:196529871-196529893 GCTAATAACTGTATTAGTTAGGG - Intronic
944431910 2:199643327-199643349 GCTGATAATTGTTTTGTTTGAGG + Intergenic
944485556 2:200201399-200201421 GCTGATAATTGTTTTGTTTAAGG - Intergenic
944528710 2:200647376-200647398 GCTGATAATTGTTTTGTTTGAGG + Intronic
944602277 2:201314888-201314910 GCTGATAATTGTTTTGTTTAAGG - Intronic
945075336 2:206032671-206032693 GCTGATAATTGTTTTGTTTAAGG - Intronic
945285818 2:208080327-208080349 GCTGATAATTGTTTTGTTTAAGG - Intergenic
945362549 2:208908661-208908683 GCTGATAATTGTTTTGTTTAAGG - Intergenic
945387189 2:209216296-209216318 TTGGCTAACTGTTTTGTTTAAGG - Intergenic
945482414 2:210359458-210359480 GCCGATAATTGTTTTGTTTGAGG + Intergenic
945825921 2:214719442-214719464 GCTAATAATTGTTTTGTTTGAGG - Intergenic
946036639 2:216747669-216747691 GCTGATAATTGCTTTCTTTGAGG - Intergenic
946207739 2:218122438-218122460 GCTGACAATTATTTTGTTTAAGG + Intergenic
946444321 2:219725368-219725390 GATAATAATTTTTTTGTTTATGG + Intergenic
946501462 2:220251579-220251601 GCTGATAATTGTTTTGTTTGAGG - Intergenic
946824164 2:223659093-223659115 GCTGATAATTGTTTTCTTTAGGG - Intergenic
947460665 2:230301488-230301510 GCTGATAATTATTTTGTTTAAGG - Intronic
947858713 2:233343058-233343080 GAAGATAACTGTTTTTTTTTGGG + Intronic
948576894 2:238958000-238958022 GCTGATAATTGTTTTGTTTAAGG - Intergenic
948714203 2:239848789-239848811 GCTGATAATTGTTTTGTTTAAGG - Intergenic
948746439 2:240097640-240097662 GCTGACAGTTGTTCTGTTTAAGG - Intergenic
1168822138 20:781915-781937 ACTGTTAACTTTTTTTTTTAAGG + Intergenic
1168941411 20:1714515-1714537 GCTGAAAATTGTTCTGTTTAAGG - Intergenic
1169336017 20:4758114-4758136 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1169359914 20:4939259-4939281 ACTGATAAATGATTTTTTTAAGG + Intronic
1169401493 20:5284351-5284373 GCTGATAATTGTTTCATTTGAGG - Intergenic
1169517269 20:6331658-6331680 GCCGATAATTGTTTTGTTTGAGG + Intergenic
1169955601 20:11099275-11099297 GCTGATAACTATTTTCTATTTGG - Intergenic
1170086400 20:12537002-12537024 GCTGATAATTGTTTTGTTTAAGG - Intergenic
1170119470 20:12895864-12895886 ACTGAGCACTCTTTTGTTTAAGG - Intergenic
1170133706 20:13050778-13050800 GCTGATAATTGTTTTGTTTGAGG - Intronic
1170245581 20:14218822-14218844 GCTGATAATTGTTTTGTTTGAGG + Intronic
1170650912 20:18240390-18240412 GGTGATAATTGTTTTGTTTAAGG - Intergenic
1170720853 20:18877903-18877925 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1170726748 20:18935743-18935765 GCTGATAATCATCTTGTTTAAGG + Intergenic
1170862977 20:20126504-20126526 GCTGATAATTGTTTTGTTTGAGG + Intronic
1171027950 20:21649359-21649381 GCTGTTAATTGTTTTGTTTGAGG - Intergenic
1171066789 20:22025264-22025286 GCTAATAATTGTCTTGTTTAAGG + Intergenic
1171165776 20:22968907-22968929 GCTGATAATTCTTTTGTTTGAGG - Intergenic
1171198378 20:23221391-23221413 GCTGATAATCATTTTGTTTAAGG + Intergenic
1171242128 20:23579872-23579894 GCTGACAATTATTTTGTTTCAGG + Intergenic
1173040477 20:39457661-39457683 GCTGCTAACTGCTTTGATGATGG - Intergenic
1173439788 20:43066027-43066049 GCTGGTAGCTATTTTTTTTAAGG - Intronic
1175475068 20:59266492-59266514 GCTGAAAACTGTTGGGTCTATGG + Intergenic
1177069443 21:16485256-16485278 GCTGATAATTGTTTTGTTTTAGG + Intergenic
1177127896 21:17218505-17218527 GCTGATAATTATTTTGTTTAAGG - Intergenic
1177174261 21:17687823-17687845 GCTCATAATTGTTTTGTTTGAGG + Intergenic
1177176630 21:17706448-17706470 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1177195352 21:17899102-17899124 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1177364378 21:20115704-20115726 GCTGATAGTTATTTTGTTTAAGG + Intergenic
1177432669 21:21010902-21010924 ACTAATCACTGTTTTGTTTCAGG + Intronic
1177579010 21:22994972-22994994 GCTGATAATTATTTTGTTTAAGG + Intergenic
1177661355 21:24087330-24087352 GCTGATAATTGTTTTGTTTAAGG - Intergenic
1177681224 21:24374167-24374189 GCTGATAACTGTTTTGTTTAAGG + Intergenic
1178038364 21:28610257-28610279 GCTAATAATTGTTTTGTTTAAGG - Intergenic
1178059553 21:28836339-28836361 GCTAATAATTGTTTTGTTTGAGG - Intergenic
1178669898 21:34581170-34581192 TCTAATAACTTTTTTTTTTAAGG + Intronic
1178801848 21:35802755-35802777 ACTGATAATTGTTTTGTTTGAGG - Intronic
1178959219 21:37048717-37048739 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1179083983 21:38201074-38201096 GCTGATAATTGTTTTGTTTGAGG + Intronic
1179177691 21:39021110-39021132 TCTGGTTGCTGTTTTGTTTAGGG - Intergenic
1179443486 21:41412899-41412921 GCTGATAATTATTTTGTTTAAGG - Intergenic
1179466451 21:41578488-41578510 TCTGATAATTATTTTATTTAGGG + Intergenic
1179467606 21:41587709-41587731 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1180040045 21:45271751-45271773 GCTGATAATTACTTTGTTTGTGG - Intronic
1180220023 21:46352652-46352674 GCTGACAACTGTGTTGTTTTAGG - Intronic
1180250870 21:46586919-46586941 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1180454734 22:15503720-15503742 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1180536757 22:16399420-16399442 GCAGATAATTGTTTCGTTTGAGG - Intergenic
1180989762 22:19928363-19928385 GCTGAGTAGTGTTCTGTTTATGG - Intronic
1181623288 22:24105542-24105564 GCTGAGAGCTGATTTCTTTAGGG - Intronic
1182422081 22:30253631-30253653 GCTGCTTCCTGTTCTGTTTATGG - Intergenic
949189804 3:1237752-1237774 ACTAATAGTTGTTTTGTTTAAGG - Intronic
949489950 3:4579909-4579931 GCTAATAAAGGTTTTTTTTAAGG - Intronic
949749488 3:7334305-7334327 GCTGATAATTATTTTGTTTAAGG - Intronic
950588060 3:13910556-13910578 GCTGACAATTATTTTGTTTCAGG - Intergenic
950599046 3:14015729-14015751 GCTGATAATTGTTTTGTTTGAGG + Intronic
950603240 3:14055035-14055057 GCTGGTAATTGTTTTGTTTGAGG + Intronic
950743434 3:15067769-15067791 GCTTATAATTTTTTTGTTGAAGG + Intergenic
950820133 3:15748480-15748502 GCAGATAATCGTTTTGTTTAAGG + Intronic
951153564 3:19322481-19322503 GCTGATAATTGTTTTGTTTTAGG + Intronic
951198338 3:19849114-19849136 GCTGATAATTATTTTGTTTAAGG - Intergenic
951218811 3:20048354-20048376 GCTGAGGACTGTTTTGTTTTAGG + Intronic
951268295 3:20596244-20596266 GCTGATAATTGTTTTGTTTAAGG + Intergenic
951294659 3:20919013-20919035 AGTGATAATTGTTTTGTTTAAGG - Intergenic
951302523 3:21016183-21016205 GCTGATAATTGTTTTGCTTAAGG + Intergenic
951326137 3:21303648-21303670 GCTGATAATTATTTTGTTTAAGG - Intergenic
951568056 3:24031983-24032005 GTTGAAACCTGTTTTGTTCAAGG + Intergenic
951690849 3:25395190-25395212 GCTGATAATTGTTTTGTTTAAGG + Intronic
951852079 3:27152345-27152367 GCTGATAATTGTTTAGTTTGAGG - Intronic
952083038 3:29783401-29783423 GCTGATAATTGTTTTGTTTAAGG - Intronic
952122871 3:30265458-30265480 GCTGATAATTCTTTTGTTTAAGG - Intergenic
952183075 3:30940054-30940076 GCTGATAATTATTCTGTATAGGG + Intergenic
952431264 3:33225566-33225588 GCTGTTCATTGTTTTGTTTCGGG - Intergenic
952435060 3:33265652-33265674 GCTGATAATTATTTTGTTTGAGG + Intergenic
952522245 3:34173267-34173289 GCTGATAATTATTTCATTTAAGG + Intergenic
952601669 3:35090418-35090440 GCTGACAATTGTTTTGTTTGAGG - Intergenic
952689682 3:36190753-36190775 GCTGATAATTGTTTTGTTTGAGG + Intergenic
952714756 3:36469374-36469396 GCTGATAATTGTTCTGTTTAAGG + Intronic
952732646 3:36654820-36654842 GCTGATAATTGTTTTGTTTAAGG - Intergenic
952993878 3:38857848-38857870 GCTGACAATTATATTGTTTATGG - Intronic
953185444 3:40633172-40633194 ACTGATAATTATTTTGTTTAAGG - Intergenic
953276875 3:41509677-41509699 GCTGAAAATTATTTTGTTAAAGG - Intronic
953723779 3:45380183-45380205 GCTGATAATTGTTTTGTTTGAGG + Intergenic
954480022 3:50790605-50790627 ACTGATAATTGTTTTGTTTAAGG + Intronic
955175463 3:56609862-56609884 GCTGATAATTTTTTTGTTTGAGG + Intronic
955450588 3:59063129-59063151 GCTGATAATTGTTTTGTTTCAGG + Intergenic
955461448 3:59188284-59188306 ACTGATAATTGTTTTGTTTGAGG + Intergenic
955477372 3:59352098-59352120 GCTGATAATTGTTTTGTTTGAGG + Intergenic
955496344 3:59537185-59537207 GATGATAAATGTTCTGTTTATGG + Intergenic
955859930 3:63318043-63318065 ACTGAAAATTGTTTTGTTTGAGG + Intronic
956338543 3:68193206-68193228 GCTGCTAACTGTGGTATTTAGGG + Intronic
956377206 3:68627316-68627338 GCTGATAATTGTTTTGTTTAAGG + Intergenic
956469989 3:69556288-69556310 GTTGAATACTGTGTTGTTTAGGG + Intergenic
956682594 3:71795177-71795199 GTTTATAACTGTTTTGTAGAGGG - Intergenic
956950432 3:74275501-74275523 GCTGATAATTGTTTTGTTTGAGG - Intronic
956995489 3:74822937-74822959 GCTGATAATTGTTTTGTTTGAGG + Intergenic
957002885 3:74907416-74907438 GCTGAAACCTGTGTTGTTCAAGG - Intergenic
957016227 3:75068102-75068124 GCTGATAATTGTTTTGTTTGAGG + Intergenic
957331470 3:78769865-78769887 GCTAATAATTGTTTTGTTTGAGG + Intronic
957971864 3:87392106-87392128 GCTGGTAATTTTTTTGTTTGAGG - Intergenic
958003131 3:87776930-87776952 GCTGATAATTGTTTTGTTTGAGG + Intergenic
958013987 3:87916059-87916081 CCTGATAATTGTTTTGTTTGAGG - Intergenic
958064386 3:88524605-88524627 GCTGATAATTGTTTTGTTTAAGG + Intergenic
958066488 3:88550553-88550575 GCTTATCATTGCTTTGTTTATGG + Intergenic
958262770 3:91402470-91402492 GCTGATGTTTGTTTTGTTTGAGG + Intergenic
958480619 3:94642060-94642082 GCTGATAATTGTTTTGTTTGAGG + Intergenic
958490341 3:94764943-94764965 GCTAATAATGGTTTTGTTTGAGG + Intergenic
958505778 3:94974987-94975009 GCTGATAATTGTTTTGGTTGAGG - Intergenic
958613276 3:96455342-96455364 GCTGGTAACTGTCTTGATTATGG - Intergenic
958767748 3:98390731-98390753 GCTGAAGACTGTTCTGTTTGTGG + Exonic
958770829 3:98423313-98423335 GCTGATAATTGTTTTGTTTGAGG - Intergenic
958787198 3:98611309-98611331 GCTGATAATTGTTTTGTTTAAGG + Intergenic
958969766 3:100599289-100599311 GCTGATAATTGTTTTGTTTGTGG + Intergenic
959009570 3:101059846-101059868 GCTGATAATTGTTTTGCTTAAGG + Intergenic
959039715 3:101406922-101406944 GCTGATAATTGTTTTGTTTGAGG - Intronic
959125740 3:102288960-102288982 GCTGATAATTGTTTTGTTTAAGG + Intronic
959279936 3:104324823-104324845 GCTGACAATTGTTATGTTTGAGG - Intergenic
959436345 3:106319023-106319045 GCTGATAATTGTTTTGTTTATGG - Intergenic
959519356 3:107307664-107307686 TCTGATAACTTATATGTTTATGG - Intergenic
959666411 3:108927018-108927040 GCTGATAATTGCTTTGTTTAAGG + Intronic
959715565 3:109429754-109429776 GCTGATAATTGTTTTGTTTGAGG + Intergenic
959722135 3:109504160-109504182 GCTGATAATTGCTTTGTTTGAGG + Intergenic
959727258 3:109558475-109558497 GCTGACAATTATTTTGTTTAAGG + Intergenic
959756805 3:109909462-109909484 GCTGATAGTTTTTTTGTTTGAGG + Intergenic
959802365 3:110510989-110511011 GGCGATAATTGTTTTGTTTGAGG + Intergenic
959867716 3:111290600-111290622 GGTGATAATAGTTTTGTTTAAGG + Intergenic
959875320 3:111375035-111375057 ACAGATAATTGTTTTGTTTGAGG - Intronic
960152905 3:114269422-114269444 GCTGATAATTAGTTTGCTTAAGG + Intergenic
960512685 3:118570292-118570314 GCTGATAATTGTTTTGTTTGAGG + Intergenic
960516705 3:118609670-118609692 GCTGATAATTGCTTTGTTTAAGG - Intergenic
960712167 3:120542584-120542606 GCTGACAATTATTTTGTTTAAGG + Intergenic
960756626 3:121020613-121020635 CCTGATAATTGTTTTGTTTAAGG - Intronic
960761862 3:121080610-121080632 GCTGACAATTATTTTGTTTAAGG + Intronic
961130912 3:124466966-124466988 GCTGAAAACTGATTTATTTCAGG - Intronic
961184697 3:124904460-124904482 GCTGTTAACTGATTGGTTTATGG + Intergenic
961389027 3:126541569-126541591 ACTGATCACTGTGTGGTTTAGGG - Intronic
961967788 3:130924362-130924384 GCTGATAATTGTTTTGTTGAAGG + Intronic
961977925 3:131046395-131046417 GCTGATAATTATTTTCTTTTAGG + Intronic
962034604 3:131637888-131637910 GCTGATAATTTTTTTCTTTAAGG - Intronic
962065842 3:131979984-131980006 GCTGATAATTGTTTTGTTTGAGG + Intronic
962147261 3:132853832-132853854 GCTGATAATTGTTTTGTTTAAGG + Intergenic
962401676 3:135065987-135066009 GGTGATAATTGTTTTGCTTGAGG + Intronic
962504782 3:136035514-136035536 GCTGATAATTGTTTTGTTTGAGG + Intronic
962673573 3:137734703-137734725 GCTGATAATTGTTTCATTTAAGG + Intergenic
962709589 3:138074412-138074434 GCTGATAATTGTTTTGTTTAAGG - Intronic
962764766 3:138551220-138551242 GCTGATAATTGTTTTGTTTAAGG - Intronic
962862010 3:139413007-139413029 GCTGACAATTATTTTGTTTCAGG + Intergenic
962999511 3:140665293-140665315 GCTGATATCTGTTTTGTTTAAGG - Intergenic
963213380 3:142718574-142718596 GGTGATAATTGTTTTGTTTAAGG - Intergenic
963280196 3:143377006-143377028 GTTGATAACTGTTAAGTTTGGGG + Intronic
963522353 3:146371606-146371628 GCTGAAAAGTGTTTTGTTTAAGG + Intergenic
963585141 3:147176896-147176918 GCTGGTAATTGTTTTGTTCAAGG - Intergenic
963623129 3:147636724-147636746 GATGATAATTATTTTGTTTAAGG - Intergenic
963832631 3:150024392-150024414 GCTGATAATTGTTTTGTTTAAGG - Intronic
964017649 3:151966441-151966463 GCTGAAAATTGTTTTGTTTAAGG - Intergenic
964075829 3:152690133-152690155 ACAGATAATTGTTTTGTTTAAGG - Intergenic
964160814 3:153642446-153642468 GCTGATAATTGTTTTGTTTGAGG - Intergenic
964221431 3:154350943-154350965 GCTGTTTACTATATTGTTTAGGG + Intronic
964226620 3:154410083-154410105 GATGATGATTGTTTTGTTTAAGG - Intronic
964299520 3:155272459-155272481 ACTGATAATTGTTTTGTTTAAGG - Intergenic
964331766 3:155610566-155610588 GCTGATAATTATCTTGTTTGAGG - Intronic
964342704 3:155725065-155725087 CCTGATAATTGTTTTGTTTAAGG + Intronic
964639649 3:158894920-158894942 GCAGATAACTATTTTCTTTTCGG - Intergenic
964772802 3:160241715-160241737 GCTGATAATCGTTTTGTTTAAGG - Intronic
964867596 3:161278149-161278171 GCTGATAATTGTTTTGTTTAAGG - Intergenic
965154192 3:165025690-165025712 GCTGATAATTGTTTTGTTTAAGG - Intronic
965184727 3:165447972-165447994 GCTGATAATTGTTTTGTTTAAGG - Intergenic
965216707 3:165873512-165873534 GCTGAAGATTGTTTTGTTTGAGG + Intergenic
965296452 3:166953799-166953821 GTTGATAATTGTTTTGTTTAAGG + Intergenic
965304941 3:167052402-167052424 GAAGATAACTGCTTGGTTTAGGG - Intergenic
965745587 3:171921641-171921663 GCTGATAATTATTTTGTTTAAGG - Intronic
965874215 3:173298070-173298092 ATTGATAATTGTTTTGTTTGAGG + Intergenic
966117517 3:176483804-176483826 GATGATAATTGTTTTGTTTGAGG + Intergenic
967209250 3:187151973-187151995 GCTGATAATTATTATGTTTGAGG - Intronic
967257346 3:187607622-187607644 GCTGATAATGGTTTTGTCTGAGG + Intergenic
967504751 3:190240826-190240848 GCTAATAATTATTTTGTTTAAGG - Intergenic
967559120 3:190897159-190897181 GCTGATAATTGTTTTGCATCAGG - Intergenic
967651519 3:191991698-191991720 GCTGATAATTATTTTGTTTGAGG - Intergenic
967741405 3:193007030-193007052 GCTGATAATTGTTTTGTTTGAGG + Intergenic
967958532 3:194899467-194899489 GCTGACAATTATTTTGTTTAAGG + Intergenic
968125484 3:196156703-196156725 GCTGATAATTGTTTTGTTTGAGG + Intergenic
969165488 4:5306926-5306948 GCTGAAAACTGTTTTGTTTAAGG + Intronic
969911346 4:10449511-10449533 GCTGATTTCTGTTTCATTTAAGG - Intronic
969947147 4:10795615-10795637 GCTGATGATTGTTTTGCTTGAGG + Intergenic
970283122 4:14479978-14480000 GCTGATAATTGTTTTGTTTAAGG - Intergenic
970549133 4:17162214-17162236 GCTGATAATTGTTTTGTTTGAGG + Intergenic
970658458 4:18258838-18258860 GCTGATTATTGTTTTGTTTGAGG + Intergenic
970996262 4:22270327-22270349 GCTGATAATTGTTTTGTTTGAGG - Intergenic
971050247 4:22854094-22854116 GCTGATAATTGTATTGTTTAAGG + Intergenic
971182944 4:24348095-24348117 GCTGATAATTGCTTTGTTTGAGG + Intergenic
971554799 4:28000739-28000761 GCTGATAATTGTTTTGTTTAAGG + Intergenic
971720758 4:30243084-30243106 ACTGACAATTATTTTGTTTAAGG + Intergenic
971900887 4:32657091-32657113 ACTGATAATTATTTTGTTTGAGG + Intergenic
971938357 4:33183488-33183510 ACTGATAATTGTTTTGCTTAAGG + Intergenic
972048979 4:34703986-34704008 GCTGATAATTGTTTTGTTTGAGG - Intergenic
972188896 4:36567223-36567245 GCTGATAATTGTTTTGTTTGAGG + Intergenic
972806629 4:42534860-42534882 GCCGATAATTGTTTTATTTGAGG - Intronic
972826950 4:42769461-42769483 GCTGATAATTGTCTTGTTTAAGG - Intergenic
973037346 4:45422737-45422759 ACTGATAATTATTTTGTTTCAGG + Intergenic
973068992 4:45834298-45834320 GCTAATAATTGTTTTGTTTAAGG + Intergenic
973070679 4:45854932-45854954 GCTGATAATTCTTTTGTTTAGGG + Intergenic
973091638 4:46145067-46145089 GCTGACAATTATTCTGTTTAAGG + Intergenic
973179406 4:47250240-47250262 GCTGATAATTGTTTTGTTTGAGG + Intronic
973244353 4:47994967-47994989 GCTGATAATTGTTTTGTTTGAGG + Intronic
973342897 4:49024639-49024661 GCTGATAATTTTTTGGTTTAAGG + Intronic
973675884 4:53262540-53262562 GCTGATAATTGTTCTGTTTATGG + Intronic
973787247 4:54343556-54343578 GCTGATAATTGTTTTGTTTGAGG - Intergenic
973831342 4:54763122-54763144 GCTGATAATTGTTTGATTTGAGG + Intergenic
973920311 4:55677296-55677318 GCTGATAATTGTTTTATTTAAGG - Intergenic
973933257 4:55815344-55815366 GCTAATAAATGTTTTTCTTAAGG - Intergenic
974038033 4:56834188-56834210 TCATATAATTGTTTTGTTTATGG - Intergenic
974127295 4:57711597-57711619 GCTGATAATTGTTTTGTTTAAGG - Intergenic
974165227 4:58192558-58192580 GGTGATAATTGTTTTGTTTAAGG - Intergenic
974457863 4:62151317-62151339 GCTGATAATTGTCGTGTTTGAGG - Intergenic
974472242 4:62333122-62333144 GCTGATAATTATTTTGTTTGAGG - Intergenic
974534054 4:63152089-63152111 GCTGACAACTATTTTGTTTAAGG + Intergenic
974712376 4:65615988-65616010 GTTCATAGCAGTTTTGTTTATGG + Intronic
974801645 4:66826723-66826745 GCTGATAATTGTTCTGTTTAAGG + Intergenic
974848964 4:67382536-67382558 GCTGACAATTATTTTGTTTAAGG - Intergenic
974857548 4:67478402-67478424 GCTGATAATTGTTTTATTTAAGG - Intronic
974895779 4:67936569-67936591 TCTGATTACCTTTTTGTTTAGGG - Intronic
975034136 4:69659898-69659920 GCTGGTACTTGTTTTGTTTGAGG - Intergenic
975061963 4:70014468-70014490 GCTGATAGTTGTTTTGTTTAAGG + Intergenic
975204244 4:71625721-71625743 GCTGATAATTGTTTTGTTTAAGG - Intergenic
975243642 4:72093119-72093141 GCTGAAAATTGTTTTGTTTAAGG + Intronic
975517422 4:75261693-75261715 GCTAATAATTGTTTTATTTGTGG - Intergenic
975534754 4:75437286-75437308 GCTGATAATTGTTTTGTTTAAGG - Intergenic
975679036 4:76857295-76857317 GCAGGTAAGTGATTTGTTTAAGG - Intergenic
975838238 4:78447135-78447157 TCTGAAAACTTTTTTGCTTAAGG - Intronic
976452502 4:85207133-85207155 GCTGATAATTATTTTGTTTAAGG + Intergenic
976464985 4:85357023-85357045 GCTGATAATTATTTTGTTTAAGG + Intergenic
976556364 4:86454983-86455005 GCTGATAATTGTTTTGTTTGAGG - Intronic
976562617 4:86519904-86519926 GCTAATAATTATTTTGTTTAAGG + Intronic
976686160 4:87818051-87818073 GCTCATAATTGTTTTGTTTGAGG + Intergenic
976888014 4:90009234-90009256 GCTGATAATTGTTTTGTCTAAGG - Intergenic
976907744 4:90261387-90261409 GCTGACAATTGTTCTGTTTAAGG + Intronic
976970714 4:91098838-91098860 GCTGAGAATTGTTTTTTTAAAGG + Intronic
977455251 4:97251294-97251316 ACTGATAACTATTTTAATTAAGG + Intronic
977474097 4:97482910-97482932 GCTAATAATTGTTTTGTTTGAGG - Intronic
977489405 4:97692899-97692921 GCTGATAATTGTTTTGTTTAAGG - Intronic
977510627 4:97957771-97957793 GCTTATAGTTGTTTTGTTTAAGG - Intronic
977549482 4:98425089-98425111 GCTGATAATTGCTTTCTTTAAGG - Intronic
977635691 4:99295161-99295183 GCTGGTAATTGTTTTGTTTAAGG - Intergenic
977746950 4:100560094-100560116 GCTGATAATTGTTTTGTTTGAGG - Intronic
977778131 4:100947554-100947576 GGTGATAATGTTTTTGTTTAGGG - Intergenic
977905863 4:102477126-102477148 GCTAATAACTGTTTTGTCCAAGG - Intergenic
978027755 4:103898364-103898386 GCTGACTGCTCTTTTGTTTAAGG - Intergenic
978158348 4:105515630-105515652 GCTGATAATTGTTTTGTTTAAGG + Intergenic
978199658 4:106011084-106011106 ACTGATAATTGTCTTGTTTAAGG + Intergenic
978201816 4:106031429-106031451 GCTGATAATCGTTTCATTTAAGG + Intergenic
978316775 4:107446951-107446973 GCTGATAATTGTTTTGTTTGAGG + Intergenic
978726512 4:111976233-111976255 GCTGACAATTGTTTTGTTCAAGG + Intergenic
978761999 4:112362938-112362960 GCTGACAACTGTTTTGTTTAAGG - Intronic
978925085 4:114233013-114233035 GCTGATAATTGTTTTGTTTAAGG - Intergenic
978999260 4:115198026-115198048 GCTGATAATTGTTTTGTTTGAGG + Intergenic
979030010 4:115632087-115632109 GTTGATAATTGTTTTGTTTAAGG + Intergenic
979061577 4:116068231-116068253 GATGATAATTGTTTTGTTTAAGG - Intergenic
979357156 4:119717573-119717595 GCTGATAATTGTTTTGTTTAAGG - Intergenic
979461764 4:120991910-120991932 GCTGATAGTTATTCTGTTTAAGG + Intergenic
979561829 4:122109640-122109662 ACTGATAATTGTTTTGTTTGAGG - Intergenic
979641910 4:123018268-123018290 GCTGTTCACTGTTTTCATTAGGG + Intronic
979705058 4:123710909-123710931 GCTGATAATTGTTTTGTTTGAGG - Intergenic
979794770 4:124833540-124833562 GCTGATTATTGTTTTGTTTGAGG + Intergenic
980033578 4:127858002-127858024 GCTGCTAATTGTTTTGTATAAGG - Intergenic
980087042 4:128402398-128402420 GCTGATAATTGTTTTGTTTGAGG + Intergenic
980238015 4:130133328-130133350 GCTGATAATTGTTTTGTTTGAGG - Intergenic
980391932 4:132158174-132158196 GCTGATAATTGTTTTGTTTAAGG + Intergenic
980409800 4:132402510-132402532 ACTGATAATTGTTTAGTTTAAGG + Intergenic
980523780 4:133962705-133962727 GCTGATAATTGTTTTGTTTGAGG - Intergenic
980761250 4:137237314-137237336 GCTGATAATTGTTTTGTTTAAGG + Intergenic
981289269 4:143055518-143055540 GCTGATAATTATTTTGTTTGGGG + Intergenic
981346816 4:143685350-143685372 GCTGATAATTACTTTGTTTGAGG - Intronic
981387380 4:144147397-144147419 GCTGATAATTATTTTGTTTAAGG - Intergenic
981626157 4:146757669-146757691 GCTGGTAATTGTTTTGTTTAAGG - Intronic
981642218 4:146957682-146957704 ACTTATAAATGTCTTGTTTATGG + Intergenic
981760615 4:148191271-148191293 GCTGATAACTGTTTTGTTTGAGG + Intronic
981825013 4:148929963-148929985 GCTGATAATTGTTTTGTTTGAGG - Intergenic
982189689 4:152841677-152841699 GCTGATAATTGTTTTGCTTGAGG + Intronic
982299352 4:153863595-153863617 GCTGATAATCGTTTTGTTTAAGG + Intergenic
982491920 4:156040060-156040082 GCTGATAATTGTTTCGTTTGAGG - Intergenic
982630763 4:157826091-157826113 GCTGGTAATTGTTTTGTTTTAGG - Intergenic
982679979 4:158417690-158417712 GCTGATAATTGTTTTGTTTGAGG + Intronic
982782178 4:159502752-159502774 GCTGTTAACTGTCTTGTCCAAGG + Intergenic
982800145 4:159696188-159696210 GCTGATAAATATTTTGTTTAAGG + Intergenic
982829916 4:160046032-160046054 GCTGATACTTGTTTTGTTTAAGG - Intergenic
982991964 4:162287559-162287581 GCTGATAATTGTTTTGTTTAAGG - Intergenic
983036012 4:162866508-162866530 GCTGATAATTGTTTTGTTTAAGG - Intergenic
983277612 4:165637098-165637120 GCTGATAATTGTTTGGTTTAAGG - Intergenic
983359777 4:166713219-166713241 GCTGCTAACTGTCTTGTATCAGG - Intergenic
983660061 4:170122212-170122234 GCTATTAACAGTTTTGTTTCAGG - Intergenic
983754822 4:171321626-171321648 GCTGATAATTGTTTTGTTTAAGG - Intergenic
983845426 4:172512731-172512753 GCCAACAATTGTTTTGTTTAAGG + Intronic
983962912 4:173776603-173776625 GTTGATAATTGTTTTGTTTAAGG + Intergenic
984066684 4:175056507-175056529 GCTAATAATTGTTTTGTTTAAGG - Intergenic
984234455 4:177138752-177138774 GCTAATAATTGTTTTGTTTAAGG - Intergenic
984266484 4:177503737-177503759 GCTGATAATTGTTTTGTTTGAGG + Intergenic
984474970 4:180224525-180224547 GCTGATAATTGTTTTGTTTGAGG + Intergenic
984527383 4:180874077-180874099 GCTGGTAATTGTTTTATTTGAGG + Intergenic
984721853 4:182979767-182979789 AGTGATAATTGTTTTGTTTGAGG - Intergenic
985008434 4:185558528-185558550 GCTGATAATTGTCTTGTTTGAGG + Intergenic
985108105 4:186519072-186519094 GCTGATAATTGTTTTGTTTAAGG + Intronic
985288735 4:188364097-188364119 GCTAATAATTGTTTTGTTTAAGG - Intergenic
985326279 4:188774727-188774749 GCTGATAATTGTTTTGTTTAAGG + Intergenic
985355918 4:189118482-189118504 GCTGGTAATTGTTTTGTTTATGG - Intergenic
986012657 5:3730291-3730313 GCAGCTAACTGTTTTTGTTAGGG + Intergenic
986080666 5:4389441-4389463 GCTAACAACTTTTTTGTGTATGG + Intergenic
986617712 5:9637216-9637238 GCTGACAATTATTTTGTTTCAGG + Intronic
986634199 5:9803594-9803616 GCTGATATTTGCTTTGTTTGAGG - Intergenic
986870397 5:12038169-12038191 GCTGATAATCATTTTGTTTGAGG - Intergenic
987030239 5:13970576-13970598 GCTGATAATTGTTTTGTTTAAGG + Intergenic
987231110 5:15894404-15894426 GCTGATAACATTTTTATTTCAGG + Intronic
987436742 5:17904501-17904523 GCTAATAATTGTTTTGTTTAAGG + Intergenic
987577890 5:19753830-19753852 GCTGATAGTTGTTTTGTTTGAGG - Intronic
987638520 5:20579208-20579230 GCTGTTTTCTGTTTTGTTTTTGG - Intergenic
987640274 5:20603230-20603252 GCTGATAATTGTTTTGTTTAAGG - Intergenic
987902051 5:24024865-24024887 ACTAATAATTGTTATGTTTAAGG - Intronic
988002365 5:25364589-25364611 CCTGATAATTGCTTTGTTTAAGG - Intergenic
988030501 5:25757399-25757421 GTTGAAACCTGTTTTGTTCAAGG + Intergenic
988125112 5:27022596-27022618 GCTGATAACTGAATTTGTTACGG + Intronic
988220493 5:28339982-28340004 GGGGAGAACTGTTTTATTTAGGG + Intergenic
988278286 5:29112122-29112144 TCTGATGATTATTTTGTTTAAGG + Intergenic
988306831 5:29503750-29503772 TCTGAGAACTGTTTTGTATCTGG - Intergenic
988344771 5:30022476-30022498 GCTGATAATTGTTTTGTTTGAGG - Intergenic
988444757 5:31273065-31273087 GCTGACAACTTTTATTTTTATGG - Intronic
988725017 5:33918217-33918239 CCTGATAATCGTTTTGTTTAAGG + Intergenic
988876064 5:35447086-35447108 GCTGGTAATTGTTTTGTTTAAGG - Intergenic
988889669 5:35600931-35600953 GCTGATAACTGTTTTGTTTAAGG - Intergenic
988902402 5:35747023-35747045 GCTGATAATTGTTTCGTTTGAGG - Intronic
988929700 5:36025253-36025275 GTTGAAAATTGTTTTGTTTCAGG - Intergenic
989027465 5:37084131-37084153 GCTGCTAATTGTTTTGTTTGAGG - Intergenic
989072990 5:37532047-37532069 GCTGAAAATTGTTTTGTTTAAGG + Intronic
989355316 5:40537946-40537968 GCTGATAATTGTTTTGTTTAAGG + Intergenic
989525733 5:42452189-42452211 ACTGACAATTATTTTGTTTAAGG + Intronic
989533641 5:42538464-42538486 ACTAATAATTGTTTTGTTTGAGG + Intronic
989562614 5:42869468-42869490 GCTGATAATTGTTTTGTTTAAGG + Intronic
989694246 5:44181243-44181265 GCTGATAATTGTTTTGTTTAAGG + Intergenic
989818266 5:45763066-45763088 GCTGACAATTATTTTGTTTAAGG + Intergenic
990155092 5:52867759-52867781 GAGGCTAACTGATTTGTTTAAGG + Intronic
990233507 5:53740689-53740711 GCTGATAATTGTTTTGTTTGAGG - Intergenic
990572940 5:57096791-57096813 GCTGATAATTGTTTTGTTTGAGG - Intergenic
990712661 5:58603102-58603124 GCTGATAATCGTTTTGTTTGAGG + Intronic
990776145 5:59308520-59308542 GCTGATAATTGTTTTGTTTGAGG + Intronic
990891676 5:60657580-60657602 GCTGATAATTATTTTGTTTAAGG + Intronic
990899576 5:60736160-60736182 GCTGATAATTGTTTTGTTTGAGG + Intergenic
991387184 5:66102875-66102897 GCTGATAATTATTTTGTTTGAGG - Intergenic
991623146 5:68567019-68567041 GCTGTTACTTGTTTTCTTTAAGG - Intergenic
991924048 5:71685777-71685799 GCTGGTAATTGTTTTGCTTGAGG - Intergenic
992239652 5:74754065-74754087 GTTGATAATTGTTTTGTTTAAGG - Intronic
992599694 5:78386747-78386769 GCTGATAATTGTTTTCTTTAAGG + Intronic
992898809 5:81271785-81271807 GCTGATAATTGTTTTGTTTAAGG - Intergenic
993365890 5:87033805-87033827 GCTGGTAATTGTTTTGTTTCAGG + Intergenic
993883719 5:93393398-93393420 GCTGATAATTGTTTTGTTTGAGG + Intergenic
993917227 5:93757582-93757604 GCTGATAATTGTTTTGTTTGAGG - Intronic
993964935 5:94348498-94348520 GCTGAGAATTGTTTTGTTTGAGG - Intronic
994034175 5:95179529-95179551 GTTGATAATTGTTTTGTTTAAGG - Intronic
994051144 5:95364299-95364321 GCTGATAATTGTTTTGTTTAAGG + Intergenic
994330038 5:98493669-98493691 GCTGAAAATAGTTTTGTTTGAGG - Intergenic
994358138 5:98818162-98818184 GCTGATAATTACTTTGCTTAAGG - Intergenic
994496720 5:100521746-100521768 CCTGATAGTTGTTTTGTATAAGG - Intergenic
995317737 5:110795930-110795952 GCTGATAATTGTTTTATTTGAGG + Intergenic
995450978 5:112300436-112300458 GCTGATAATTGTTTTGTTTAAGG + Intronic
995699094 5:114913755-114913777 GATGATAATTATTTTCTTTAAGG - Intergenic
995727537 5:115197295-115197317 GCTGATAATTGTTTTGTTCGAGG - Intergenic
995817985 5:116193014-116193036 GCTGATAATTGTTTTGTGTGAGG - Intronic
995955493 5:117771306-117771328 GCTGATAACTGTTTTGTTTGAGG - Intergenic
996010930 5:118480556-118480578 GCTGATAATTATTTTGTTTGAGG - Intergenic
996032134 5:118717073-118717095 GCTGATAATTGTTTTGTTTGAGG - Intergenic
996123905 5:119703986-119704008 GCTGATAATTATTTTGTTTGAGG + Intergenic
996197963 5:120633082-120633104 GCTGATAATTGTTATGTTTAAGG - Intronic
996288771 5:121827665-121827687 GCTGATAATTGTTTTGTTTGAGG + Intergenic
996325577 5:122268867-122268889 GCTGATAATTGTTTTGTTTGAGG - Intergenic
996454980 5:123671117-123671139 GGTGACAACTTTTTTGGTTAGGG + Intergenic
996495140 5:124147201-124147223 GCTGATGATTGTTTTGTTTAAGG + Intergenic
996504624 5:124255831-124255853 GCTGATAATTGTTTTGTTTTAGG + Intergenic
996519898 5:124414846-124414868 ACTGAAAACTGTTATGCTTATGG + Intergenic
996632008 5:125644131-125644153 GCTGACAATTATTTTGTTTGAGG - Intergenic
996678502 5:126203692-126203714 GCTGATAATTGTTTTGTTTAAGG - Intergenic
996694757 5:126381982-126382004 GCTGATAATTGTCTTGTTTAAGG + Intronic
996780087 5:127176103-127176125 GCTGATAATGGTTTTGTTTAAGG + Intergenic
996838869 5:127824164-127824186 GCTGCTAATTGTTTTCTTAAGGG - Intergenic
996875211 5:128233736-128233758 GCTGATAATTCTTTTGTTTAAGG + Intergenic
997058666 5:130475678-130475700 GCTGACAATTATTTTGTTTAAGG + Intergenic
997109386 5:131058311-131058333 GCAGATAACTGTTTTGGGGATGG - Intergenic
997761098 5:136447925-136447947 GCTGATAATTGTTTTGTTTGAGG - Intergenic
997765405 5:136498656-136498678 GCTGATAACTGTTTGGTTTAAGG + Intergenic
998314246 5:141166551-141166573 GCTGATATCTTTTTTGGTTTTGG - Intergenic
998746232 5:145262540-145262562 GCTGATAGTTGTTTTATTTAAGG - Intergenic
998758762 5:145409071-145409093 GCTGACAATTATTTTCTTTAAGG - Intergenic
998777113 5:145616028-145616050 ACTGATAATTGTTTTGTTTGAGG + Intronic
999086270 5:148893254-148893276 GCTGATAATTATTTTGTTTCAGG - Intergenic
999337682 5:150736461-150736483 GTTGATAATTGTTTTGTTTAAGG - Intronic
999484524 5:151982472-151982494 ACTGATAATTGTTTTGTTTGAGG + Intergenic
999677260 5:154016467-154016489 GCTGATAATTGTTTTGTTTGAGG - Intronic
999801102 5:155037659-155037681 GCTGATAATTGTTTTGTTTGAGG + Intergenic
999818795 5:155203459-155203481 GCTGATAATTGTTTTGTTTGAGG - Intergenic
999822867 5:155246420-155246442 GCTGACAATTATTTTGTTTCAGG + Intergenic
999839087 5:155404722-155404744 GCTGATAATTGTTTTGTTTAAGG - Intergenic
999913246 5:156229454-156229476 ACTGATAATTGTTTTGTTTGAGG + Intronic
999930628 5:156429807-156429829 GCTTACAATTGTTTTGTTTAAGG + Intronic
1000158894 5:158580450-158580472 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1000222327 5:159225797-159225819 GCTGATAACTGTATTAATTCAGG + Intergenic
1000237836 5:159378993-159379015 GCTGACAATTATTTTGTTTAAGG - Intergenic
1000264657 5:159623170-159623192 GCTTATAATTGTTTTGTTTAAGG - Intergenic
1000692912 5:164345122-164345144 CCTCATCACAGTTTTGTTTAAGG + Intergenic
1000757741 5:165182755-165182777 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1000779869 5:165466693-165466715 ACTGATAATTGTTTTGTTTGAGG - Intergenic
1000892103 5:166812496-166812518 GCTGATAACAGTTTTGTTAGGGG - Intergenic
1001166847 5:169376230-169376252 GCTGATAATTATTTTGTTTAAGG - Intergenic
1001176997 5:169479608-169479630 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1001290877 5:170458550-170458572 GCTGATAATTGTTTTGTTTAAGG - Intronic
1001693599 5:173652619-173652641 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1001693605 5:173652675-173652697 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1001733594 5:173980085-173980107 GCTGATATTTGTTTCGTTTAAGG + Intronic
1002849224 6:978130-978152 GCTGATAATTATTTTGTTTAAGG + Intergenic
1003029255 6:2587881-2587903 GGTGATAAATGTTTTGTTTGAGG + Intergenic
1003063323 6:2879111-2879133 GCTGATCATTGTTTTGTTTGAGG - Intergenic
1003253152 6:4450506-4450528 TCTAATAACTGTTCTGTATATGG - Intergenic
1003297307 6:4843090-4843112 GCTTATAATTGTTTTGTTTAAGG + Intronic
1003465120 6:6371956-6371978 GCTGATAATTCTTTTATTTAAGG - Intergenic
1003582132 6:7349262-7349284 GCTGATAATTGTTTTGGTTGAGG - Intronic
1003930244 6:10917934-10917956 GCTGATAATTGTTTTGTTTGAGG + Intronic
1004114554 6:12753653-12753675 GCTGAGATCTGTTTTGGTTCTGG + Intronic
1004600317 6:17143715-17143737 GCTGATAAATATTTGGTTTAAGG + Intergenic
1004888703 6:20076293-20076315 GCTGATAATTGCTTTGTTTAAGG - Intergenic
1005072670 6:21876026-21876048 GCTGGTCATTGTTTTGTTTGAGG - Intergenic
1005170329 6:22977756-22977778 GCTGATACCTTGTTTTTTTATGG + Intergenic
1005259303 6:24041152-24041174 GCTGATAATTACTTTGTTTCAGG + Intergenic
1005305572 6:24511111-24511133 GCTGATAATTGCTTTGTTTGAGG + Intronic
1005760484 6:28962925-28962947 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1007349693 6:41260450-41260472 ACTGATAATTATTTTGTTTCAGG - Intergenic
1007892838 6:45311666-45311688 GCTGAAGATTGTTTTGTTTGAGG - Intronic
1008042125 6:46813839-46813861 ACTAATAATTGTTTTGTTTAAGG + Intronic
1008171857 6:48217503-48217525 GCTGATAATTGTTTTGTTTAAGG - Intergenic
1008256304 6:49304176-49304198 GCTGATAATTGCTTTGTTTGAGG - Intergenic
1008305487 6:49893743-49893765 GCTGATAATTATTTTGTTTGAGG - Intergenic
1008471799 6:51892766-51892788 GCTAATAAATGTTTTTTTAATGG - Intronic
1008528450 6:52432493-52432515 GCTGATAATTCTTTTGTTTAAGG + Intronic
1008699710 6:54084322-54084344 GAAGATAACAATTTTGTTTATGG + Intronic
1008736135 6:54546424-54546446 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1008775250 6:55030643-55030665 GCTGGCAATTGTTTTGTTTGAGG + Intergenic
1008973406 6:57396955-57396977 GCTGATAATGATTTTGTTTGAGG + Intronic
1008992642 6:57620415-57620437 GCTGATGTTTGTTTTGTTTGAGG - Intronic
1009162311 6:60298499-60298521 GCTGATAATGGTTTTGTTTGAGG + Intergenic
1009181262 6:60519526-60519548 GCTGATGTTTGTTTTGTTTGAGG - Intergenic
1009360128 6:62801476-62801498 GCTGTTAAGTGTTTGGTTTAAGG + Intergenic
1009389537 6:63129475-63129497 GCTGATAATTGTTTTGCTTGAGG + Intergenic
1009453349 6:63826595-63826617 GCTGATAATTGTTTTGTTTGAGG - Intronic
1009495064 6:64335828-64335850 GCTGATAATCATTTTGTTTGAGG - Intronic
1009547655 6:65041917-65041939 GCACAAAACTGTTTTATTTATGG + Intronic
1009589279 6:65644768-65644790 GCTGATAATTGTTTTGTTTAAGG - Intronic
1009624658 6:66124826-66124848 GCTGATAGTTATTCTGTTTAAGG + Intergenic
1009644465 6:66379634-66379656 GCTGGTAATTGTTTTGTTTAAGG - Intergenic
1009867072 6:69410585-69410607 GCTGATAATTGTTTTGTTTAAGG - Intergenic
1009969012 6:70606352-70606374 GCTGATAATTGTTTTGCTTGAGG - Intergenic
1010017244 6:71119748-71119770 GCTAACAATTATTTTGTTTAAGG + Intergenic
1010045462 6:71437735-71437757 GCTAATAGTTGTTTTGTTTAAGG - Intergenic
1010358419 6:74964069-74964091 GCTGATAATTATTTTGTTTAAGG + Intergenic
1010479706 6:76336654-76336676 GCTGATAATTGCTTTATTTAAGG + Intergenic
1010518298 6:76801821-76801843 ACTGATAATTGTTTTGTTTAAGG + Intergenic
1010633523 6:78229638-78229660 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1010707600 6:79133711-79133733 GCTGATAATTGTTTCATTTGAGG + Intergenic
1010801715 6:80184724-80184746 GCTGATAATTATTTTATTTAAGG + Intronic
1010817396 6:80374939-80374961 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1010879720 6:81152734-81152756 GCTGACAATTGTTTTGTTTAAGG - Intergenic
1010982751 6:82388216-82388238 GCTCATAACAGTTATTTTTAAGG - Intergenic
1011005414 6:82638962-82638984 GCTGACAATTATTTTGTTTAAGG - Intergenic
1011028513 6:82895506-82895528 GCTGATAATTCTTTGTTTTAGGG - Intronic
1011093341 6:83632137-83632159 GCTGATAATTGTTTTATTTGAGG + Intronic
1011132969 6:84071369-84071391 GCTGGTAATTGTTTGGTTTGAGG + Intronic
1011156471 6:84339429-84339451 GCTGATAATCATTTTGTTTAAGG + Intergenic
1011168803 6:84480828-84480850 GCTGATAATTGGTTTGTTTGAGG - Intergenic
1011233488 6:85189282-85189304 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1011319804 6:86079098-86079120 GCCGATAATTGCTTTGTTTGAGG + Intergenic
1011327332 6:86163414-86163436 GCTGATAATTTTTTTGTTTGAGG - Intergenic
1011328905 6:86182479-86182501 GCTGATAATTGTTTTGTCTGAGG + Intergenic
1011365973 6:86583196-86583218 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1011373396 6:86664849-86664871 GCTAATAATGGTTTTGTTTAAGG + Intergenic
1011620250 6:89236020-89236042 TCTGATAATTGTTTCGTTTAAGG + Intergenic
1011817682 6:91212151-91212173 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1011833886 6:91405904-91405926 GCTGATAATTGCTTTGTTTGAGG - Intergenic
1011893134 6:92192700-92192722 GTTAATAATTGTTTTGTTTAAGG + Intergenic
1011965654 6:93154810-93154832 GCTGATCATTGTTTTGTTTCAGG + Intergenic
1012156125 6:95821381-95821403 CTTGATAATTGTTTTGTTTGAGG - Intergenic
1012204548 6:96444066-96444088 ACTGATAGTTGTTTTGTTTAAGG - Intergenic
1012208195 6:96488030-96488052 GCTTATAATTGTTTTGTTTGAGG + Intergenic
1012299072 6:97562302-97562324 GCTGATAATTGCTTTGTTTAAGG + Intergenic
1012393975 6:98774553-98774575 GCTGAGAACTTTTTTTTTTTGGG - Intergenic
1012581341 6:100873730-100873752 GCTGATAATTGTTTTGTTTAAGG - Intronic
1012737994 6:102975081-102975103 GCTGATAATTGTTTCATTTGAGG - Intergenic
1012793971 6:103736092-103736114 GCTGATAATTGTTATGTTTGAGG - Intergenic
1012870012 6:104661065-104661087 GCTGGTAATTATTTTGTTTCAGG - Intergenic
1012922897 6:105237130-105237152 GCTGACAATGGTTTTGTTTGAGG - Intergenic
1012965795 6:105671259-105671281 GCTGATAATTATTTTGTTTAAGG - Intergenic
1013532451 6:111032499-111032521 GATCATAACACTTTTGTTTAAGG - Intergenic
1013720894 6:113027206-113027228 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1013852473 6:114533236-114533258 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1013946284 6:115726863-115726885 GCTGATAATTGTTTCATTTAAGG + Intergenic
1013985374 6:116186158-116186180 TATGATAATTATTTTGTTTAAGG + Intronic
1014055745 6:117013901-117013923 AGTGATAATTGTTTTGTTTAAGG + Intergenic
1014285138 6:119488419-119488441 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1014304673 6:119726097-119726119 GCTGATAATTATTTTGTTTGAGG + Intergenic
1014312981 6:119829025-119829047 GCTAATAATTCCTTTGTTTAAGG + Intergenic
1014336998 6:120148867-120148889 GTTGATAAGTGTTTTGTTTGAGG - Intergenic
1014421191 6:121247175-121247197 GCTGACAATTATTTTGCTTAAGG - Intronic
1014481884 6:121949580-121949602 ACTAATAATTGTTTTGTTTAAGG + Intergenic
1014531218 6:122562245-122562267 GCTGATAATTGTTTTGTTTGAGG + Intronic
1014566722 6:122957790-122957812 GCTGATAATTGTTTTGTTTAAGG - Intergenic
1014581549 6:123143441-123143463 GCTGATAATTATTTTGTTTAAGG - Intergenic
1014604067 6:123449920-123449942 GCTGATGATTGTTCTGTTTGAGG - Intronic
1014658409 6:124134996-124135018 GCTGCCAATTGTTTTGTTTGAGG - Intronic
1014739210 6:125127279-125127301 GCTGATAATTGTTTTGTATGAGG - Intronic
1014878184 6:126686977-126686999 CCTGACAATTATTTTGTTTAAGG - Intergenic
1015222319 6:130818120-130818142 GCTGATAACTGTTTTGTTTGAGG - Intergenic
1015345755 6:132156198-132156220 TCTGATAAGTGATTTGTTTTGGG - Intergenic
1015362196 6:132353450-132353472 GCTGATAATTGTTTTGTTTGAGG + Intronic
1015565753 6:134568750-134568772 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1015644042 6:135367149-135367171 GCTGATGATTGTTTTGTTTAAGG + Intronic
1015663138 6:135599035-135599057 GCTGATACTTGTTTTGTTTGAGG + Intergenic
1015849621 6:137558752-137558774 GCTGATAATTATTTTGTTTGAGG + Intergenic
1015877796 6:137841658-137841680 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1015900024 6:138054820-138054842 GATGATAATTGTTTTGTTTAAGG - Intergenic
1016216158 6:141606552-141606574 GCTGATAATTGTTTCACTTAAGG + Intergenic
1016289803 6:142516909-142516931 GTTGATAATTGTTTTGTTTGAGG + Intergenic
1016365768 6:143316382-143316404 ACTGATAATTGTTTTGTTTAAGG + Intronic
1016484920 6:144527284-144527306 GCTTGTAATTGTTTTGTTTAAGG + Intronic
1016496894 6:144673932-144673954 GCTGATAGTTATTTTGTTTAGGG + Intronic
1016735396 6:147473052-147473074 GCTGACAATTGTTATGTTTAAGG + Intergenic
1016909964 6:149189078-149189100 GCTGATAATTGTTTCGTTTAAGG + Intergenic
1016947910 6:149551235-149551257 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1017190317 6:151646976-151646998 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1017326263 6:153144568-153144590 GCTGATAATTGTTTGATTGAAGG + Intergenic
1017535141 6:155339617-155339639 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1018114773 6:160572695-160572717 ACTGATAATTGTTTTGTTTGAGG + Intronic
1018233659 6:161701456-161701478 GCTGATAAACATTTTATTTAGGG + Intronic
1018353107 6:162983596-162983618 GCTGATAATTATTTTGTTTGAGG + Intronic
1018596886 6:165490297-165490319 GCTGATAATTGTTTTGTTTAAGG - Intronic
1018665802 6:166136503-166136525 GCTGACAATTGTTTTGTTTGAGG - Intergenic
1018712401 6:166506326-166506348 GCTGATTACTGTTGTCTTTTTGG + Intronic
1018755444 6:166844623-166844645 GCTGATAATTGTTTTCTTTAAGG - Intronic
1019108873 6:169693194-169693216 GCTGACAATCATTTTGTTTAAGG - Intronic
1019123238 6:169822096-169822118 GCTGGTAATTGTTTTGTTTAAGG + Intergenic
1020332202 7:7031033-7031055 GCTGATAATTATTTTGTTTGAGG + Intergenic
1020373918 7:7463523-7463545 GCTGATAATTGTTTTGTTTGAGG - Intronic
1020608730 7:10368598-10368620 GCTAATAATTATTTTGTTTCAGG - Intergenic
1020635072 7:10686398-10686420 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1020762391 7:12284407-12284429 TCTGATAAGTGTTTTCTTTCTGG - Intergenic
1020860965 7:13490934-13490956 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1020995610 7:15259760-15259782 GCTCATAACTGTTTTGTTTAAGG - Intronic
1021323595 7:19240674-19240696 GCTGCTAATTGTTTCATTTAAGG + Intergenic
1022295516 7:29047894-29047916 GCTGATAATTGTTTTGTTTGAGG - Intronic
1022564993 7:31390626-31390648 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1022691884 7:32664123-32664145 ACTGTAAACTGCTTTGTTTAGGG - Intergenic
1023096247 7:36662550-36662572 GCTGATGACTGCTGTCTTTATGG + Intronic
1023144536 7:37136576-37136598 GCCGATAATTGTTTTGTTGAAGG - Intronic
1023411301 7:39891591-39891613 GCTGATAACTGGTTTCTGTAAGG + Intergenic
1023537570 7:41230038-41230060 GCTGATAATTGCTTTGCTTAAGG + Intergenic
1023657466 7:42439513-42439535 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1023692620 7:42806934-42806956 GCTGATAAATGTTTTGTTTAAGG - Intergenic
1023701438 7:42894945-42894967 GTTGATAATTGTTTTGTTTGAGG - Intergenic
1023748793 7:43350152-43350174 GCTGATAATTGTTTTGTTTGAGG + Intronic
1024327841 7:48125802-48125824 GCTGATAATTGTTTTGTTTAGGG + Intergenic
1024367133 7:48534262-48534284 GCTGATAATTGCTTTGTTTAAGG + Intronic
1024545672 7:50515260-50515282 GCTGACAATTGTTTTGTTTGAGG - Intronic
1024665451 7:51542658-51542680 GCTGATAGTTGTTTTGTTTAAGG + Intergenic
1024669123 7:51576111-51576133 GCTGATGATTGTTTTGTTTGAGG + Intergenic
1024745191 7:52398580-52398602 GCTGATAATTGTTTTGGTTGAGG + Intergenic
1024782475 7:52867018-52867040 GCTGACAATTATTCTGTTTAAGG - Intergenic
1024840194 7:53576351-53576373 GCTGATAATTGTTTTGTTTAAGG - Intergenic
1024863218 7:53870821-53870843 GCTGACAATTATTCTGTTTAAGG - Intergenic
1024946990 7:54818743-54818765 ACTGATAATTGTTTTGTTTAAGG + Intergenic
1025772947 7:64530004-64530026 GCTGATAATTGTTTTGTTTGAGG - Intronic
1025794664 7:64728256-64728278 TCTGATAATTGTTTTGTTCAAGG + Intergenic
1025820774 7:64960850-64960872 GCTAATTATTGTTTTATTTAAGG - Intergenic
1027350219 7:77304518-77304540 GCTGATACTTGTTTTGCTTGAGG + Intronic
1027417480 7:77988860-77988882 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1027563020 7:79756399-79756421 GCTGATAATTGCTTTGTTTAAGG + Intergenic
1027699393 7:81450751-81450773 GCTTATAATTGTTTTGTTTGAGG - Intergenic
1028250777 7:88538090-88538112 GCTGATCATTGTTTTGTTTAAGG + Intergenic
1028401754 7:90432586-90432608 GCTGACAATTATTTTGTTTAAGG - Intronic
1028502048 7:91529354-91529376 GCTGATAAGTGTTTTGTTTAAGG - Intergenic
1028792758 7:94872256-94872278 GCTGGTAATAGTTTTGTTTAAGG + Intergenic
1028818471 7:95177220-95177242 GGTGATCATTGTTTTGTTTGAGG - Intronic
1028962060 7:96760441-96760463 GCTGATAATTGTTGTGTTTAAGG + Intergenic
1028993284 7:97073782-97073804 ACTGATAATTATTTTGTTTGAGG + Intergenic
1029053336 7:97712823-97712845 CCTGATAATTGTTTTATTTAAGG - Intergenic
1030325375 7:108213097-108213119 ACTGATAATTGTTTTGTTTGTGG - Intronic
1030390276 7:108919645-108919667 GTTGATAATTATTTTGTTTGAGG + Intergenic
1030936168 7:115586728-115586750 GCTGATAATGGTTTTGTTTGAGG - Intergenic
1030972484 7:116077128-116077150 GCTGATAATAGTTTTGCTTAAGG - Intronic
1031090271 7:117346542-117346564 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1031139031 7:117920603-117920625 GCTGATAATTATTTTGTTTAAGG - Intergenic
1031147966 7:118017990-118018012 GCTGATAATTGCTTTGTTTAAGG - Intergenic
1031257319 7:119470574-119470596 GCTGAGAACTGTTCTGGTTTTGG + Intergenic
1031261517 7:119526548-119526570 GCTGATAATTGTTTTGTTTAAGG - Intergenic
1031761091 7:125714626-125714648 GCTGACAATTGTTTTGTTTTAGG + Intergenic
1031796750 7:126185030-126185052 GCTGATAATTATTTTGCTTGAGG + Intergenic
1031799185 7:126221687-126221709 GCTGATAATCATTTTGTTTAAGG + Intergenic
1031879395 7:127178691-127178713 GCTGATAATTGTTTTGTTTGAGG - Intronic
1032288828 7:130567664-130567686 GCTGATAATTATTTTTTTTAAGG - Intronic
1032289446 7:130575405-130575427 GCTGGTAATTGTCTTGTTTGAGG - Intronic
1032448749 7:132008472-132008494 GTGGATAATTATTTTGTTTAAGG + Intergenic
1032605112 7:133342325-133342347 GCTGATAATTGTTTTGTTTAAGG + Intronic
1032931684 7:136679470-136679492 GCTGATAATTGTTTTGTTTAAGG - Intergenic
1033026992 7:137783829-137783851 GCTGGTAACTGTTTTGCTTAAGG - Intronic
1033114054 7:138609699-138609721 GCTCATTACTGTTTTTTTTTTGG + Intronic
1033400954 7:141024772-141024794 GCTGATAATTGTTTTGTTAAAGG + Intergenic
1033603129 7:142903800-142903822 GCTGGAAACTTTTTTATTTAAGG + Intergenic
1033623059 7:143079431-143079453 ACTGATGATTGTTTTGTTTAAGG - Intergenic
1033816512 7:145080937-145080959 GATGATAATTGTTTTGTTTAAGG + Intergenic
1034058687 7:148066072-148066094 GCTTTTAATTATTTTGTTTAAGG + Intronic
1034683020 7:152945614-152945636 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1034705334 7:153138140-153138162 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1035151387 7:156875667-156875689 GCTGATAATTGTTTTGTTTAAGG - Intronic
1035591283 8:816511-816533 GCTGGTAATTGTTTTGTTTAAGG + Intergenic
1036827523 8:11989248-11989270 GCTGACAGTTGTTCTGTTTAAGG - Intergenic
1037320662 8:17639565-17639587 GATGATGATTCTTTTGTTTAAGG + Intronic
1037713435 8:21375156-21375178 GCTGATAATTGTTTTCTTTGAGG + Intergenic
1038237246 8:25770888-25770910 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1038367041 8:26947061-26947083 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1039083123 8:33753960-33753982 GCTGATAATTATTTTGTTTGAGG + Intergenic
1039095381 8:33879455-33879477 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1039641650 8:39229034-39229056 GCTGATAATTGTTTTGTCTGAGG - Intronic
1039763708 8:40606467-40606489 GCTGATAATTATTTTGTTTAAGG + Intronic
1039810336 8:41042590-41042612 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1039939226 8:42075142-42075164 GCTGAACAGTGTATTGTTTAGGG + Intergenic
1040362578 8:46681695-46681717 GCTGACTATTATTTTGTTTAAGG + Intergenic
1040442659 8:47460947-47460969 GCTGATAATTGTTTTGTTTAAGG + Intronic
1040635495 8:49269076-49269098 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1040670933 8:49689975-49689997 GCTGATAATTGCTTTGTTTAAGG + Intergenic
1040800418 8:51333190-51333212 GCTGAAGATTGTTTTGTTTGAGG - Intronic
1040867842 8:52068863-52068885 GCTGACAATTATTTTGTTTGAGG + Intergenic
1041150487 8:54927274-54927296 GCTGATAATCATTTTATTTAAGG - Intergenic
1041227945 8:55718557-55718579 GCTGATAATTGTTTTGTTTGAGG - Intronic
1041293485 8:56331484-56331506 GGTGATAATTGTTTTGTTTGAGG + Intergenic
1041312963 8:56535098-56535120 GTTTAAAACTGTGTTGTTTAAGG + Intergenic
1041570370 8:59331702-59331724 GCTAATAATTGTTTTGTTTGAGG + Intergenic
1041832195 8:62166428-62166450 GCTAATAATGGTTTCGTTTAAGG - Intergenic
1041848851 8:62363483-62363505 CCTGATAGCTGTTTTCTTCAAGG + Intronic
1041897306 8:62939606-62939628 GCTGATAATCGTTTTGTTTAAGG - Intronic
1042084358 8:65091254-65091276 GCTGACAATTATTTTGTTTAAGG - Intergenic
1042122651 8:65505703-65505725 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1042160742 8:65891792-65891814 GCTGACAGTTGTTTTGTTTAAGG - Intergenic
1042430118 8:68696456-68696478 GCTCAGTACTGTGTTGTTTAAGG - Intronic
1042431561 8:68712038-68712060 GGTAATAATTGTTTTGTTTAAGG - Intronic
1042465498 8:69125740-69125762 GCTGATAATTATTTTGTTTAAGG + Intergenic
1042466961 8:69139499-69139521 GCTAATAATTGTTTTGTTTGAGG + Intergenic
1042645387 8:70980927-70980949 GCTGATAATTGTTTCATTTAAGG + Intergenic
1042728857 8:71909116-71909138 GTGGATAATTATTTTGTTTAAGG + Intronic
1042768264 8:72351278-72351300 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1042897006 8:73681318-73681340 ACTGATAATTATTTTATTTAAGG - Intronic
1043040943 8:75261033-75261055 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1043071544 8:75642212-75642234 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1043121512 8:76331305-76331327 GCTGATAATTGTTTCGTTTGAGG + Intergenic
1043270871 8:78331114-78331136 GCTGATAATTGTTTTATTTGAGG - Intergenic
1043494274 8:80782970-80782992 GTTGAAAACTGTGTTGTTCAAGG + Intronic
1043545278 8:81307988-81308010 TCTGATAATTGTTTTGTTTAAGG - Intergenic
1043679076 8:82998491-82998513 GCTGATCATTTTTTTGTTTAAGG - Intergenic
1043778634 8:84303445-84303467 GCTGACAACTGTGTTGTTGTAGG + Intronic
1043876205 8:85489821-85489843 ACTGATAATTGTTTTGTTTAAGG + Intergenic
1043985679 8:86693017-86693039 GCTGATTATTGTTTTGTTTAAGG + Intronic
1043988003 8:86716572-86716594 GCTGCTAATTGTTTTGTTTAAGG - Intronic
1044227773 8:89738353-89738375 GCTGATAATTGCTTTGTCTGAGG - Intergenic
1044788084 8:95817684-95817706 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1044903501 8:96973723-96973745 GCTGATAATTGTTTTGTTTAAGG - Intronic
1044947716 8:97406653-97406675 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1045094965 8:98787785-98787807 GCTGATAATTGTTTTGTTTGAGG - Intronic
1045122140 8:99049449-99049471 GCAGATAATTGCTTTGTTTAAGG + Intronic
1045598004 8:103678882-103678904 GGTGGTTACTGTTTTTTTTAAGG + Intronic
1045634684 8:104170941-104170963 GCTGACAGTTATTTTGTTTAAGG + Intronic
1045671206 8:104554977-104554999 GCTGATAGTTGTTTTGTTTAAGG - Intronic
1045779995 8:105851210-105851232 GCTAATAATTGTTTTGTTTGAGG - Intergenic
1046369411 8:113281965-113281987 GCTGATAATTGTTTTGTTTGAGG + Intronic
1046394771 8:113626987-113627009 GCTGAAAATTGTTTTGTTTAAGG - Intergenic
1046975555 8:120272147-120272169 GCTGACAGTTATTTTGTTTAAGG - Intronic
1046977337 8:120295670-120295692 TCTCATAATTGATTTGTTTAAGG - Intronic
1047032536 8:120897780-120897802 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1047227157 8:122966442-122966464 ACTGGTAATTATTTTGTTTAAGG + Intronic
1047277175 8:123415191-123415213 GCTGATAATTGTTTTGTTTGAGG + Intronic
1047437635 8:124847922-124847944 GAGGATAACTGGTTTGTTCAGGG - Intergenic
1047592174 8:126338045-126338067 GCTGACAATTATTTTGTTTCAGG - Intergenic
1047607121 8:126486515-126486537 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1047669742 8:127132422-127132444 GCTATTATCTGTATTGTTTATGG + Intergenic
1047901678 8:129430038-129430060 GCAGATAATTGTTTTGCTTAAGG + Intergenic
1047937306 8:129795379-129795401 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1048120266 8:131572922-131572944 GCTAAAAATTGTTTTGTTTAAGG + Intergenic
1048227036 8:132597682-132597704 GCAGATAATTGTTTTCTTCAAGG - Intronic
1048371514 8:133782373-133782395 ACTGATAATTATTTTGTTTAAGG + Intergenic
1048530881 8:135249399-135249421 GCTGATCATTGTTTTGTTTAAGG + Intergenic
1049086538 8:140482781-140482803 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1049295813 8:141836680-141836702 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1049869615 8:144964297-144964319 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1049897926 9:127977-127999 GCTGATAATTGTTTTGTTTGAGG + Intronic
1050053700 9:1629970-1629992 GCTGCTTTCTGTATTGTTTATGG + Intergenic
1050133445 9:2437820-2437842 GCTAATAATTGTTTTGTTCAAGG + Intergenic
1050133743 9:2440134-2440156 GCTGACAGCTATTTTGTTTCAGG + Intergenic
1050147559 9:2585028-2585050 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1050502866 9:6316675-6316697 GCTGATAACTGTTTTGTTTGGGG - Intergenic
1050521342 9:6503596-6503618 GAAAATAAATGTTTTGTTTATGG + Intronic
1050903695 9:10976684-10976706 GCTGATAACTGTTTTGTTTAAGG - Intergenic
1050972150 9:11891836-11891858 GCTGATAACTGTTTTGCTTAAGG + Intergenic
1051362854 9:16296269-16296291 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1051601187 9:18876541-18876563 GCTGATAATAGTTTTGTTTAAGG + Intronic
1051733361 9:20171070-20171092 GCTGATAATTGTTTCCTTTAAGG - Intergenic
1051929630 9:22368840-22368862 GTTGATAATTGTTTTGTTTAAGG - Intergenic
1052000668 9:23275843-23275865 GCTGCCAACTATTTAGTTTATGG - Intergenic
1052006494 9:23356238-23356260 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1052218484 9:25994047-25994069 GCTGACAGTTGTTTTGTTTAAGG - Intergenic
1052247049 9:26348420-26348442 GCTGATAATTGTTTCGTTTGAGG - Intergenic
1052253766 9:26429169-26429191 GCTGATAATTATTTTGTTTAAGG - Intergenic
1052550102 9:29937503-29937525 GCTGATACTCGTTTTGTTTGAGG + Intergenic
1052624741 9:30961013-30961035 GCTGATAATTGTTTTGTTTTGGG + Intergenic
1053126722 9:35586874-35586896 GCTGATAATTGTTTTGTTTAAGG - Intergenic
1053231581 9:36414843-36414865 GCTGGTAATTGTTTTGTTTAAGG + Intronic
1053741006 9:41138270-41138292 GCTGATAATTGTTTTGTTTGAGG + Intronic
1053753373 9:41278602-41278624 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1054258901 9:62842965-62842987 GTTGATAATTGTTTTGTTTGAGG + Intergenic
1054332882 9:63777075-63777097 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1054443994 9:65294413-65294435 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1054486278 9:65727092-65727114 GCTGATAATTGTTTTGTTTGAGG - Intronic
1054687343 9:68293027-68293049 GCTGATAATTGTTTTGTTTGAGG - Intronic
1054938974 9:70719214-70719236 GCTGATAATTATTTTATTTAAGG - Intronic
1054940665 9:70737207-70737229 GCTGATAATTATTTTATTTAAGG - Intronic
1055125846 9:72717582-72717604 GCTGATAATTGTTTTGTTTAAGG + Intronic
1055156478 9:73068419-73068441 GCTGATAATTGTTTTGTTTAAGG - Intronic
1055244733 9:74225848-74225870 GCTGACAATTGTTTTGTTTAAGG - Intergenic
1055517508 9:77048138-77048160 GCTGCTAAGTGCTTTGTTAATGG - Intergenic
1055905629 9:81291067-81291089 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1056025837 9:82494607-82494629 GCTAATAAATGTTTTGTTTAAGG + Intergenic
1056309604 9:85325859-85325881 GCTGATAATTATTTTACTTAAGG - Intergenic
1056312754 9:85358127-85358149 GCTGACAATTATTTTGTTTAAGG + Intergenic
1056322556 9:85450696-85450718 GCTGATAATTGTTTTGCTTGAGG + Intergenic
1056396816 9:86188737-86188759 GCTGGTAATTGTTTTGTTTAAGG - Intergenic
1056696368 9:88857729-88857751 GCTGATAATTGTTCTGTTTAAGG - Intergenic
1056698869 9:88885707-88885729 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1057003994 9:91539393-91539415 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1057119281 9:92557117-92557139 GCTGATAATTGTTTTGTTTGAGG + Intronic
1057475882 9:95400850-95400872 GCTGATAATTGTTTTGTTTAAGG - Intergenic
1057789127 9:98111056-98111078 CCTGATAATTGTTTTTTTTTGGG - Intronic
1058156556 9:101523014-101523036 GCTGTTAAGTGTTTTGTTTGAGG + Intronic
1058540531 9:106007926-106007948 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1058623033 9:106904218-106904240 GCTGATAATTGTTTTGTTTGAGG + Intronic
1058784400 9:108373038-108373060 GCTAATAATTATTTTGTTTAAGG + Intergenic
1058907660 9:109494983-109495005 GCTGAAAACTGATTTGGTAATGG - Intronic
1058919106 9:109596516-109596538 GTTGAACACTCTTTTGTTTATGG + Intergenic
1059032853 9:110718936-110718958 GCTGATAATTGCTTTGTTTTAGG - Intronic
1059609420 9:115876916-115876938 GCTGATAATGGTTTTGTTTAAGG + Intergenic
1060311027 9:122462710-122462732 GCTGATAATTGTTTTGTTTATGG + Intergenic
1060314293 9:122494973-122494995 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1061667655 9:132169793-132169815 GCTTATCACTGTTGTGATTATGG + Intronic
1062705527 9:137938114-137938136 GCTGATAACTGTTTTGTTTAAGG - Intronic
1062713769 9:137991791-137991813 GCTGATAATTGTTTTGTTTAAGG - Intronic
1202799878 9_KI270719v1_random:165386-165408 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1187109122 X:16277911-16277933 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1187219027 X:17306412-17306434 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1187523343 X:20032629-20032651 GCTGAGATCAGTTTTGTTTCAGG - Intronic
1187589019 X:20694926-20694948 GCTAATAATTGTTTTGTTTAAGG - Intergenic
1187748547 X:22434954-22434976 GCTGATACTTGTTTTGTTTGAGG - Intergenic
1187752030 X:22477475-22477497 GCTGATAATTGTTTTCTTTAAGG + Intergenic
1187773437 X:22729127-22729149 GCTGATAATTGCTTTGTTTGAGG + Intergenic
1188045719 X:25424646-25424668 GCCGATAATTGTTTTGTTTGGGG + Intergenic
1188340743 X:28998192-28998214 GGTGAAAACTTTTTTTTTTAAGG - Intronic
1188389192 X:29599308-29599330 GCTGATAATTGTTTTATTTAAGG + Intronic
1188719172 X:33501683-33501705 GCTGCTAATTCTTTTGTTTAAGG - Intergenic
1188737829 X:33740715-33740737 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1189413779 X:40795929-40795951 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1189567370 X:42256525-42256547 GCTGATAATTGTTTTGTTTAAGG - Intergenic
1189599981 X:42614094-42614116 GATGATAATTTTTTTTTTTATGG + Intergenic
1189603317 X:42649957-42649979 GCTGATAATTGTTTCATTTGAGG - Intergenic
1189668455 X:43382290-43382312 GCTGATAATTGTTTTGTTTAAGG - Intergenic
1189844856 X:45126167-45126189 GCTGATAATTGTTTTGTTTACGG - Intergenic
1189945837 X:46177872-46177894 GCTGATTATTGTTTTGTTTAAGG + Intergenic
1189962210 X:46334312-46334334 GCTGATCATTGTTTTGTTTGAGG - Intergenic
1190449100 X:50559424-50559446 GCTGGTAATTGTTTTGTTTGAGG - Intergenic
1190632027 X:52397498-52397520 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1190895309 X:54612717-54612739 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1190897158 X:54632059-54632081 GCTGATAATCGTTTTGTTTAAGG + Intergenic
1190955758 X:55191760-55191782 GCTGACAGCTGTTCTGTTTAAGG + Intronic
1191045489 X:56131341-56131363 GGTGATAATTGTTTTGTTTAAGG - Intergenic
1191077134 X:56467361-56467383 GCTGACAATTATTTTGTTTCAGG + Intergenic
1191180454 X:57557591-57557613 GCTGATAATTGTTATGTGAAAGG - Intergenic
1191741690 X:64442513-64442535 GCTGACAATTGTTTTGTTTAAGG - Intergenic
1191777790 X:64835820-64835842 GCTTGTTACTGGTTTGTTTAGGG + Intergenic
1191779709 X:64852591-64852613 GCTGAAGATTGTTTTGTTTGAGG + Intergenic
1191804982 X:65126275-65126297 GCTGATAATTGTTTTGTTCCAGG + Intergenic
1191806880 X:65145772-65145794 GCTGATAATTGTTTTGCTTGAGG + Intergenic
1191813756 X:65220058-65220080 GCTAATAATTGTTTTGTTTGAGG - Intergenic
1191879475 X:65830206-65830228 ACTGACAATTGTTTTGTTTAAGG - Intergenic
1191903410 X:66062990-66063012 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1191906123 X:66092558-66092580 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1191913798 X:66180396-66180418 GCTGATAATTGTTTTGTTTGTGG + Intronic
1191917393 X:66217385-66217407 GCTGATAATTGTTTAGTTTGAGG - Intronic
1191945127 X:66525358-66525380 GCTGATCATTGTTTTGTTTAAGG + Intergenic
1191950942 X:66592287-66592309 GCAGATAATTGTTTTGCTTTAGG + Intergenic
1191965083 X:66749442-66749464 GCTGATAATTGTTTTGTTTATGG + Intergenic
1192015686 X:67327293-67327315 GCTGACAACTATTTTGTTTAAGG - Intergenic
1192164136 X:68814414-68814436 GCTGATAATTATTTTGTTTAAGG - Intergenic
1192298221 X:69872100-69872122 ATTGATAATTGTTTTGTTTAAGG - Intronic
1192550328 X:72048412-72048434 GCAGATAACTTTATTGTTTGGGG + Intergenic
1192609817 X:72556103-72556125 GTTGATAATTGTTTTGTTTAAGG - Intronic
1192673851 X:73174311-73174333 GCTAATAATTGTTTTCTTTAAGG + Intergenic
1192688485 X:73333421-73333443 GCTGGTAATTGTTTTGTTTAAGG + Intergenic
1192724654 X:73736170-73736192 GCTTTTAACTGTTTTGCTCAGGG + Intergenic
1192820391 X:74638481-74638503 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1192878302 X:75255205-75255227 GATGATAATTTTTTTGTTTGAGG - Intergenic
1192900196 X:75488372-75488394 ACTGACAATTATTTTGTTTAAGG - Intronic
1192913472 X:75630682-75630704 ACTGATAATTGTTTTGTTTGAGG + Intergenic
1192929745 X:75793237-75793259 GCTGATCAGTGTTTTGTTTGAGG - Intergenic
1192930856 X:75804286-75804308 GCTGACAATTATTTTGTTTAAGG - Intergenic
1192944873 X:75955717-75955739 GCTAATAATTGTTTTCTTTAAGG + Intergenic
1192951034 X:76016203-76016225 GCTGATAATTGTTTTGTTTAAGG - Intergenic
1192970120 X:76219913-76219935 GCTTATAATTGTTTTGTTAGAGG + Intergenic
1192978836 X:76317402-76317424 GCTAAAAATTGTTTTGTTTGAGG + Intergenic
1192994961 X:76504062-76504084 GCTGATAATTGTTATGTTTGAGG + Intergenic
1193007796 X:76640840-76640862 GCTGATAATTGTCTTATTTAAGG + Intergenic
1193062905 X:77224859-77224881 GTTGATAGTTGTTTTGTTTCAGG - Intergenic
1193077178 X:77366369-77366391 GTTGATAATTCTTTTGTTTGAGG - Intergenic
1193078122 X:77376688-77376710 GCTGATAATTGTTTTGTCTAAGG - Intergenic
1193154769 X:78160259-78160281 GCTGAAGATTGTTTTGTTTGAGG - Intergenic
1193157072 X:78185001-78185023 ACTGATAATTGTTTTGTTTGAGG - Intergenic
1193185699 X:78509371-78509393 GCTGATAATTGTTTTGTTTAAGG - Intergenic
1193197098 X:78644978-78645000 GCTGATTATTGTTTTCTTTAAGG - Intergenic
1193253229 X:79318093-79318115 GCTGATAATTGTTTTGCTTGAGG + Intergenic
1193255530 X:79344037-79344059 GCTGACAATTATTTTGTTTCAGG - Intergenic
1193265719 X:79466169-79466191 GCTGATAATTGTTCTATTTGAGG - Intergenic
1193289877 X:79760504-79760526 GCTGATAACTGCTGTGTTTTAGG + Intergenic
1193314894 X:80053655-80053677 GCTGATAACAGTTTTGTTTATGG + Intergenic
1193366476 X:80639569-80639591 GATGATAATTGCTTTGTTTAAGG - Intergenic
1193389056 X:80905648-80905670 GCTGATAATTGTTTTGTTTTAGG + Intergenic
1193405057 X:81090458-81090480 GCTAATAATTGTTTTGTTCAAGG - Intergenic
1193420983 X:81281521-81281543 GCTGATAATCATTTTGTTTAAGG - Intronic
1193423602 X:81314780-81314802 GCTGATAATTGTTTTGCTTAAGG + Intergenic
1193437934 X:81501868-81501890 GCTCATAATTGTTTTGTTTAAGG + Intergenic
1193578693 X:83234225-83234247 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1193590775 X:83386160-83386182 TCTAATAATTGTTTTATTTAAGG - Intergenic
1193617478 X:83708139-83708161 GCTGACAGCTGTTCTGTTTAAGG + Intergenic
1193625985 X:83820225-83820247 GCTGACAATTATTTTCTTTAAGG + Intergenic
1193689850 X:84628172-84628194 GCTTACAAGTATTTTGTTTAGGG + Intergenic
1193690576 X:84636346-84636368 GCTGATAATTGTTTTGTTTAAGG - Intergenic
1193723438 X:85014608-85014630 GCTGACAATTATTTTATTTAAGG + Intronic
1193736595 X:85164526-85164548 GTTGATAATTATTTTATTTAAGG + Intergenic
1193771739 X:85595296-85595318 GCTGATAATTGTTTAGTTTAAGG - Intergenic
1193775791 X:85640536-85640558 GCTGATAATTGTTTTGCTTAAGG + Intergenic
1193785850 X:85759209-85759231 GATGATAATTGTTTTGTTTGAGG + Intergenic
1193817393 X:86120719-86120741 GCTGATAATTGTTTAGTTTAAGG + Intergenic
1193924606 X:87467963-87467985 GCTGGCAATTATTTTGTTTAAGG - Intergenic
1193950872 X:87796472-87796494 GCACATAATTGTTTTGTTTAAGG - Intergenic
1194001564 X:88435858-88435880 GCTGACAATTATTTTGTTTAAGG - Intergenic
1194095172 X:89630893-89630915 GCTTATAATTGTTTTGTTTAAGG + Intergenic
1194165513 X:90509514-90509536 GCTGATAATTGTTTTGTTTAAGG - Intergenic
1194183963 X:90748687-90748709 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1194214278 X:91109398-91109420 GCTGATAATTATTTTGTTTAAGG + Intergenic
1194232129 X:91337147-91337169 GCTGATAATTGTTTTGTTTAAGG - Intergenic
1194237363 X:91400629-91400651 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1194262848 X:91718230-91718252 GCTGACAATTTTTTTCTTTAAGG - Intergenic
1194298880 X:92161305-92161327 GCTGATAATTATTTTGTTTAAGG + Intronic
1194438912 X:93905245-93905267 GCTAATAATTATTTTGTTTAAGG + Intergenic
1194445488 X:93982353-93982375 GCTGATAATTATTTTGCTTGAGG + Intergenic
1194465946 X:94235852-94235874 ACTGATAATTGTTTTGTTTGAGG + Intergenic
1194468343 X:94259557-94259579 GCTGATAATTGTTTTGCTTAAGG - Intergenic
1194470095 X:94283912-94283934 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1194471273 X:94301021-94301043 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1194532968 X:95073428-95073450 GCTGATAATTGTTTCATTCAAGG - Intergenic
1194543294 X:95202098-95202120 ACTGATAATTGTTTTGTTTGAGG + Intergenic
1194553947 X:95334444-95334466 GGTGATAATTGTTTTGTTTAAGG - Intergenic
1194596534 X:95865857-95865879 GCTGACAGTTGTTCTGTTTAAGG - Intergenic
1194601421 X:95925667-95925689 TCTAATAATTGTTTTGTTTAAGG - Intergenic
1194630437 X:96275988-96276010 GCTGATAATTGTTTTGTTTAAGG - Intergenic
1194881671 X:99260030-99260052 GCTGATAATTGTTTTATTTACGG + Intergenic
1194882412 X:99270614-99270636 GTTGATAATCGTTTTGTTTGGGG + Intergenic
1194926751 X:99835141-99835163 GCTAATAATTGTTTTGTTTGAGG + Intergenic
1194967517 X:100305276-100305298 GCTGATAATTGTTTCATTTAAGG - Intronic
1195015970 X:100781408-100781430 ACTGATAATTGTTTTGTTTGAGG + Intergenic
1195019337 X:100811318-100811340 GCTGATAATTATTTTGTTTGAGG + Intergenic
1195076148 X:101328704-101328726 GCTGATAATTGTTTTGTTCGAGG - Intergenic
1195231814 X:102858030-102858052 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1195237293 X:102913026-102913048 GCTGATAATTGTTTTGCTTAAGG - Intergenic
1195270442 X:103223782-103223804 GCTCATAACTGGTTTGTTCAGGG - Intergenic
1195795628 X:108643567-108643589 GCTGATAATTGTTTTGTTTGAGG - Intronic
1195838443 X:109145506-109145528 GCTGATAATTGTTTTGTTTAAGG - Intergenic
1195855367 X:109326180-109326202 GCTGATAATTGTTTTGTTTAAGG - Intergenic
1195972651 X:110490537-110490559 GCTGATAGTTGTTTTGTTTAAGG + Intergenic
1196024172 X:111022380-111022402 GCTGATAATTGTTTTGTTGAAGG - Intronic
1196161489 X:112488835-112488857 TCTGATAATTATTTTGTTTGAGG - Intergenic
1196171059 X:112588918-112588940 ACTGATAATTGTTTTGTTCTAGG - Intergenic
1196225005 X:113156513-113156535 GCTGATAATTGTTTTGTTTTAGG + Intergenic
1196477902 X:116110606-116110628 GCTGATAATTGCTTTGTTTAAGG + Intergenic
1196519222 X:116653550-116653572 GCTGCTAATTGTTTTGTTTAAGG + Intergenic
1196530788 X:116783925-116783947 GCAGATAATTGTTTTGCTTGAGG - Intergenic
1196590327 X:117480139-117480161 ACTGATAATTGTTTTATTTGAGG + Intergenic
1196619944 X:117809858-117809880 GCTGATAATTGTTTTGTTTAAGG - Intergenic
1196675580 X:118417471-118417493 AGTGATAATTGTTTTGTTTGAGG + Intronic
1196737684 X:118993877-118993899 GCTGGTAATTGTTTTGCTTGAGG - Intronic
1196948104 X:120848881-120848903 GCTGATGATTGTTTCGTTTGAGG + Intergenic
1196949207 X:120859099-120859121 ACTGATAATTGTTTTGTTTAAGG - Intergenic
1197025431 X:121743033-121743055 GATAATTACTGTTTTTTTTATGG + Intergenic
1197027936 X:121777993-121778015 GCTGATAGTTGTTGCGTTTAAGG + Intergenic
1197034492 X:121857937-121857959 GCAGGTAATTGTTTTGTTTAAGG + Intergenic
1197055334 X:122112348-122112370 GCTGAAAATTGTTTTCTTTAAGG + Intergenic
1197066066 X:122235900-122235922 GCTGATAATTGTTTTGTTTCAGG + Intergenic
1197079881 X:122399423-122399445 GCTGACAATTATTTTGTTTAAGG - Intergenic
1197083680 X:122447839-122447861 ACTGATAATTGTTTTATATAAGG - Intergenic
1197102652 X:122674339-122674361 GCTAATAATTGTTTTATTTGAGG - Intergenic
1197120246 X:122882090-122882112 GCTAATAATTGTTTTGTTTAAGG - Intergenic
1197132575 X:123021534-123021556 GCCGATACTTGTTTTGTTTGAGG - Intergenic
1197184553 X:123571851-123571873 GCTGATAATTGTTTTGTTTAAGG - Intergenic
1197325900 X:125093045-125093067 GCTGATAAGTGTATTCTGTATGG + Intergenic
1197363740 X:125537847-125537869 GCTGGTAATTGTTTTGTTTGAGG - Intergenic
1197393139 X:125893892-125893914 GCTGATAGTTGTTTTGTTTAAGG + Intergenic
1197463572 X:126773033-126773055 GTTGATAATTGTTTTGTTTAAGG - Intergenic
1197504079 X:127279754-127279776 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1197515377 X:127421569-127421591 GTTGATCATTGTTTTGTTTAAGG + Intergenic
1197519083 X:127474552-127474574 GCTGATAATTGTTTTGTTTGAGG - Intergenic
1197545434 X:127817730-127817752 GCTGATAATTGTTTTGCTTCAGG - Intergenic
1197572007 X:128161772-128161794 GCTGATAATTGTTTTCTTTAAGG + Intergenic
1197575784 X:128209380-128209402 GCTGATAGTTGTTTTGTTTAAGG - Intergenic
1197589078 X:128385606-128385628 GCTGATAATCGTTTTGTTTGAGG - Intergenic
1197668909 X:129254512-129254534 GCCGATAATTGTTTTGTTTGAGG + Intergenic
1197671422 X:129282667-129282689 GCTGATAATTGTTTCGTTTGAGG + Intergenic
1197910820 X:131481019-131481041 GCTAATAATTGTTTTGTTTAAGG - Intergenic
1197953865 X:131925218-131925240 GCAGTTAATTGTTTTGTTTGAGG - Intergenic
1198559756 X:137836798-137836820 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1198604377 X:138321038-138321060 GCTGATAATTACTTTGTTTAGGG + Intergenic
1198613383 X:138426355-138426377 ACTGATAATTGTTGTGTTCATGG - Intergenic
1198616616 X:138464706-138464728 GCTGATAATTGTTTTGTTTTAGG - Intergenic
1198664903 X:139009504-139009526 GCTGATAATTATTTTGTTTAAGG - Intronic
1198712639 X:139522405-139522427 ACTGATTATTGTTTTGTTTAAGG - Intergenic
1198722781 X:139641900-139641922 GCTGACAACTTTTTTCTTTTAGG - Intronic
1198943130 X:141980820-141980842 GCTGATCATTGTTTTGTTTAAGG + Intergenic
1199014800 X:142803015-142803037 GCTGATAATTGTTTGGTTTAAGG + Intergenic
1199057667 X:143317684-143317706 GCTGATAATTGTTTTGTTTGAGG + Intergenic
1199277176 X:145959619-145959641 GGTGATTACTGTTTTGTTGTGGG + Intergenic
1199521335 X:148739937-148739959 GCTGATAATTGTTTTGTTTGAGG + Intronic
1199553712 X:149083011-149083033 GCTGATGGTTGTTTTGTTTAAGG - Intergenic
1199668718 X:150122643-150122665 GCTGATAACTGTTTTGCTTGAGG - Intergenic
1199913835 X:152316711-152316733 GCTGATAATTGTTTTGTTTAAGG - Intronic
1199926496 X:152471718-152471740 GCTGAAGATTGTTTTGTTTGAGG - Intergenic
1200317939 X:155154115-155154137 GTCAATAATTGTTTTGTTTAAGG + Intergenic
1200332834 X:155315461-155315483 GGTGATAATTGTTTTGTTTAAGG - Intronic
1200442589 Y:3229355-3229377 ACTGACAGTTGTTTTGTTTAAGG + Intergenic
1200447805 Y:3287072-3287094 GCTTATAATTGTTTTGTTTAAGG + Intergenic
1200511777 Y:4087323-4087345 GCTGATAATTGTTTTGTTTAAGG - Intergenic
1200530556 Y:4330618-4330640 GCTGATAATTGTTTTGTTTAAGG + Intergenic
1200738356 Y:6826255-6826277 GCTGGTAATTATTTTATTTAAGG + Intergenic
1201307852 Y:12566367-12566389 ACTGATAATTGTTTTGCTTGAGG + Intergenic
1201315960 Y:12645546-12645568 GCTGATAATTGTTTAGTTTGAGG - Intergenic
1201393446 Y:13523050-13523072 CCTGATCACTGTTTTGTTCCAGG - Intergenic
1201448788 Y:14087056-14087078 GCCAAAACCTGTTTTGTTTAAGG + Intergenic
1201915232 Y:19174333-19174355 GTTGAAAACTCTTTTCTTTAAGG - Intergenic
1201934587 Y:19394609-19394631 GCTGATAATTGCTTCATTTAAGG + Intergenic
1201953493 Y:19592896-19592918 ACTGATAACTGTTTAGGTAAAGG + Intergenic
1202043811 Y:20715724-20715746 GCTGATAATTGCTTTGTTTGAGG - Intergenic