ID: 1177681225

View in Genome Browser
Species Human (GRCh38)
Location 21:24374170-24374192
Sequence GATAACTGTTTTGTTTAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1558
Summary {0: 4, 1: 189, 2: 528, 3: 397, 4: 440}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177681219_1177681225 27 Left 1177681219 21:24374120-24374142 CCTTTTCTTCATTCATGAAGCCA No data
Right 1177681225 21:24374170-24374192 GATAACTGTTTTGTTTAAGGAGG 0: 4
1: 189
2: 528
3: 397
4: 440
1177681223_1177681225 -1 Left 1177681223 21:24374148-24374170 CCTGTATACAAAATTCTTGGCTG No data
Right 1177681225 21:24374170-24374192 GATAACTGTTTTGTTTAAGGAGG 0: 4
1: 189
2: 528
3: 397
4: 440
1177681220_1177681225 7 Left 1177681220 21:24374140-24374162 CCAGTTTCCCTGTATACAAAATT No data
Right 1177681225 21:24374170-24374192 GATAACTGTTTTGTTTAAGGAGG 0: 4
1: 189
2: 528
3: 397
4: 440
1177681222_1177681225 0 Left 1177681222 21:24374147-24374169 CCCTGTATACAAAATTCTTGGCT No data
Right 1177681225 21:24374170-24374192 GATAACTGTTTTGTTTAAGGAGG 0: 4
1: 189
2: 528
3: 397
4: 440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177681225 Original CRISPR GATAACTGTTTTGTTTAAGG AGG Intergenic
900699516 1:4035814-4035836 GATAATTGTTTTGTTTAAGCAGG - Intergenic
900723352 1:4195475-4195497 GATAGTTGTTTTGTTTAAGGAGG - Intergenic
901123354 1:6912585-6912607 GATAACTGTCTGGCTTAGGGAGG + Intronic
901403896 1:9033203-9033225 AATAACTTTTTTTTTTAAGGTGG - Intergenic
901688201 1:10956281-10956303 GATAACTGTTTTGTTCAGCCTGG - Intronic
903919049 1:26786855-26786877 GATATCTGTTGTGTGCAAGGTGG - Intergenic
906053799 1:42898569-42898591 GATAATTGTTTTGTTTGAGGAGG + Intergenic
906563840 1:46782245-46782267 GATGATTGTTTTGTTTGAGGAGG + Intronic
906594680 1:47064398-47064420 GACCATTGTTTTGTTTAAGGAGG - Intergenic
906869392 1:49460889-49460911 AATAATTGTTTTGTTTTAGGAGG + Intronic
906877002 1:49550593-49550615 AATAATTGTTTTATTTGAGGAGG + Intronic
906910693 1:49945415-49945437 GTTAATTGTTTGGTTTAATGAGG - Intronic
907349321 1:53812956-53812978 GATAATTGTTTTGTTGGAGGAGG - Intronic
907887231 1:58604543-58604565 GACAATTATTTTGTTTCAGGAGG + Intergenic
908174936 1:61546282-61546304 GATAATTGTTTTGTTTGAGGAGG + Intergenic
908237112 1:62157317-62157339 GATAACTTTTTTTTTTGAGATGG - Intronic
908298735 1:62739602-62739624 GATAATTGTTTTGTTTGAGGAGG - Intergenic
908503222 1:64765995-64766017 GTTAACTTTTTTGTTGAGGGTGG + Intronic
908660520 1:66430503-66430525 GATAATTATTTTGTTTAAGGAGG + Intergenic
908803472 1:67905422-67905444 GATAATTGTTTTGTTTAAGGAGG + Intergenic
908862096 1:68500459-68500481 GCTAATTGTTTTGTTTGAGGAGG - Intergenic
908883554 1:68760628-68760650 AATAATTATTTTATTTAAGGAGG - Intergenic
908981906 1:69968651-69968673 GATAATTGTGTTGTTTGAGGAGG - Intronic
909141239 1:71868379-71868401 GTTAACTCATTTGTTTAAGATGG - Intronic
909673814 1:78216390-78216412 GATAATTGTTTTGTTTGAGGAGG - Intergenic
909948184 1:81687960-81687982 GACATTTGTTTTGTTTGAGGAGG + Intronic
909981218 1:82103875-82103897 GATAATTGTTTTGTTTGAGGAGG + Intergenic
910232890 1:85004598-85004620 GATAATTGTTTTGTTAGAGGAGG - Intronic
910598268 1:89003672-89003694 GATAATTGTTTTGTTTGAAGAGG + Intergenic
910624106 1:89288240-89288262 GATAAATGTGTTGTATAAAGAGG + Intergenic
910738817 1:90493300-90493322 GATAATTGTTTTGTTTGAGGAGG + Intergenic
910919414 1:92327946-92327968 GACAGTTGTTTTGTTTAAGGAGG + Intronic
911065935 1:93788602-93788624 GACAATTATTTTGTTTAAGGAGG + Intronic
911265718 1:95741392-95741414 GATAATTGTCTTGTTTCAGGAGG + Intergenic
911318034 1:96377985-96378007 CATAATTGTTCTGCTTAAGGAGG - Intergenic
911447450 1:98015485-98015507 GAGAACTGATTTGATTTAGGAGG + Intergenic
911562200 1:99419434-99419456 GATAATAGTTTTGTTTAAGGCGG - Intergenic
911678737 1:100690352-100690374 GATAATTATTTTGTTTCAGGAGG + Intergenic
911689307 1:100813846-100813868 GATAATTGCTTTGTTTAAGGAGG - Intergenic
911743431 1:101412455-101412477 GATAATTGTTTTGTTTAAGGAGG - Intergenic
911794258 1:102056398-102056420 GACCATTGTTTTGTTTAAGGAGG - Intergenic
911806022 1:102209724-102209746 GATAATTGTATTGTTTAAGGTGG + Intergenic
912082166 1:105950444-105950466 GATAATTGTTTTGTTTAGGGAGG + Intergenic
912180936 1:107218745-107218767 GATAGTTGTTTTGTTTAAGGAGG + Intronic
912615984 1:111100759-111100781 GATAATTGTTTTGTTTGAGGAGG + Intergenic
913143297 1:115963256-115963278 GATAATTGTTTTGTTTGAGGAGG - Intergenic
913151524 1:116048433-116048455 GATAATTGTTCGGTTTGAGGAGG - Intronic
913236352 1:116786752-116786774 GATAATTGTTTTGTTTAAACAGG - Intergenic
913337276 1:117720113-117720135 GATAACTATTTTGTTTAAGGAGG - Intergenic
913339568 1:117745627-117745649 GATAATTGTTTTATTTAAGGAGG + Intergenic
913463906 1:119118780-119118802 GATAATTATTTTGTTTAAGGAGG - Intronic
913493684 1:119406576-119406598 GATAATTGTGTCGTTTAAGGAGG - Intergenic
913972878 1:143429175-143429197 GATAATTGTTTTGTTTGAGGAGG + Intergenic
914067262 1:144254782-144254804 GATAATTGTTTTGTTTGAGGAGG + Intergenic
914111891 1:144711572-144711594 GATAATTGTTTTGTTTGAGGAGG - Intergenic
914455363 1:147831788-147831810 GATAATTGTTTTGTTTGAGGAGG + Intergenic
914927385 1:151900005-151900027 GATAATTGTTTTGTTTGAGGAGG - Intronic
914968128 1:152279365-152279387 GATAATTGTTTTGTTTGAGGAGG - Intergenic
915055573 1:153125790-153125812 GATAATTATTTTGTTTAAGGAGG - Intergenic
915259584 1:154666914-154666936 GCTAAATGTATTGTTTAATGGGG - Intergenic
915821471 1:159029281-159029303 GATAATTGTTTTGTTTAAGGAGG + Intronic
915889518 1:159759444-159759466 GATGACAGTTTTGTCCAAGGGGG - Intergenic
916331536 1:163623439-163623461 GATAATTGTTTTGTTTAAGGAGG + Intergenic
916566199 1:165981033-165981055 AATAATTGTTTTGTTTAAGGAGG + Intergenic
916580098 1:166099095-166099117 GATAATTGTTTTGTTAGAGGAGG - Intronic
916661722 1:166928208-166928230 GATAACAGTACTGTTTTAGGTGG - Intronic
917096829 1:171406546-171406568 GATAATTATTTTGTTTAAGGAGG - Intergenic
917116145 1:171605714-171605736 TATAATTTTTTTTTTTAAGGAGG - Intergenic
917202227 1:172530061-172530083 GAGAACTGTGTTGTCTAAGATGG - Intergenic
917247696 1:173022521-173022543 GATAGCTGTATTGTATTAGGTGG - Intergenic
917319157 1:173760567-173760589 GATAATTGTTTTGTTTGAGGAGG - Intronic
917573058 1:176289978-176290000 GAGAATTATTCTGTTTAAGGAGG - Intergenic
917898297 1:179515364-179515386 GATAATTGTTTTGTTTGAGGAGG + Intronic
917913485 1:179676640-179676662 AATAATTGTTTTGTTTAAGGAGG + Intronic
918158528 1:181874113-181874135 GATAATTGTTTTGTTTGAGTAGG - Intergenic
918172034 1:182006733-182006755 GATAATTGTTTTGTTTAAGGAGG - Intergenic
918750635 1:188265323-188265345 GATAATTGTTTTGTTTGAGGAGG + Intergenic
918753589 1:188306282-188306304 GAAAACTGCTTTTTTTAACGTGG + Intergenic
918819586 1:189235694-189235716 GATAATTATTCTGTTTAAGGAGG + Intergenic
918972290 1:191434764-191434786 CATAATTACTTTGTTTAAGGAGG - Intergenic
919115348 1:193274774-193274796 GATAATTGTTTTGTTTGAGGAGG + Intergenic
919278045 1:195446103-195446125 GATAATTGTTTAGTTTGAGGAGG - Intergenic
919397749 1:197071439-197071461 GATAATTATTTTTTTTAAGGAGG - Intergenic
919407865 1:197207508-197207530 GATAATTATTTTGTTTAAGGAGG + Intergenic
919549314 1:198965174-198965196 GATAATTGTTTTGTTTGAGCAGG + Intergenic
920726797 1:208444036-208444058 GCTAATTGTTTTGTTTGAGGAGG + Intergenic
920800101 1:209178453-209178475 GATAATTGTTTTGCTTAAGGAGG - Intergenic
920989982 1:210927410-210927432 GCTAATTGTTTTGTTTAAGGAGG - Intronic
921532725 1:216305802-216305824 AATAACTGTTTTGTTTAAGGAGG + Intronic
921762733 1:218935912-218935934 GATTACTGTTGTTTTTAAGGAGG + Intergenic
922395840 1:225200647-225200669 GATAATTGTTTTGTTTAAGGAGG + Intronic
922673213 1:227530984-227531006 GATAATTGTTTTGTTTGAGGAGG + Intergenic
923174207 1:231447531-231447553 GATAATTATTTTGCCTAAGGAGG - Intergenic
923458911 1:234189917-234189939 GATAATTGTTTTGTTTAAGGAGG - Intronic
923661799 1:235963606-235963628 GATAACTGTTTTGTTTGAGGAGG - Intergenic
923874867 1:238036113-238036135 GAAAATTGTTTTGTTTGAGGAGG - Intergenic
923960953 1:239083442-239083464 GATAATTGCTTTGTTTAAGGAGG + Intergenic
923996389 1:239499833-239499855 GATAATTGTTTTGTTTGAGGAGG - Intronic
924302151 1:242650788-242650810 GATAATTGTTGTGTTTGAGGAGG + Intergenic
924321240 1:242853440-242853462 GATAATTGTTTTGTTTGAGAAGG + Intergenic
924691708 1:246357666-246357688 GATAATTGTTTTGTTTAAGGAGG - Intronic
924767929 1:247051407-247051429 GACAATTATTTTGTTGAAGGAGG + Intronic
924878003 1:248127322-248127344 GATAATTGTTTTGTTCAAAGGGG + Intergenic
924880018 1:248151064-248151086 GATAACTGTTTTGTGTAAAGAGG + Intergenic
924883127 1:248185474-248185496 GATAATTGTTTTGTTTAAAGAGG + Intergenic
924885223 1:248208612-248208634 AATAATTATTTTATTTAAGGAGG + Intergenic
1062760978 10:18631-18653 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1064237708 10:13591714-13591736 GATAACAATTTTGGTTGAGGTGG + Intronic
1064907974 10:20368810-20368832 GATGATTGTTTTGTTTGAGGAGG + Intergenic
1065470781 10:26079811-26079833 GATAATTGTTTTGTTTGAGGAGG + Intronic
1065894418 10:30150649-30150671 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1065991260 10:31012558-31012580 GATCACTGTTTTGATCTAGGGGG + Intronic
1066145358 10:32552711-32552733 GATGATTGTTTTGTTTAAGGAGG + Intronic
1066170516 10:32838833-32838855 GATAATTGTTTTATTTAAGGAGG - Intronic
1066459495 10:35600894-35600916 AGTAACTGTTTTGTTTTGGGGGG - Intergenic
1066747259 10:38613116-38613138 GATAATTGTTTTGTTCGAGGAGG - Intergenic
1068096486 10:52498617-52498639 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1068122678 10:52799954-52799976 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1068161802 10:53273777-53273799 GACAATTATTTTGTTTGAGGAGG - Intergenic
1068172953 10:53420260-53420282 GATAATCATTTTGTTTAAGGAGG + Intergenic
1068485868 10:57657519-57657541 GAGAAGTGTTTTTTTTAAGATGG - Intergenic
1068808680 10:61229571-61229593 GATAATTGCTTTGTTTAAGGAGG - Intergenic
1068924853 10:62525663-62525685 GATAATTGTTTTGTTTAAGGAGG + Intronic
1069113057 10:64469995-64470017 AATAATTCTTTTGTTTAAAGAGG - Intergenic
1069129419 10:64680713-64680735 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1069146210 10:64895035-64895057 GACAATTATTTTGTTTGAGGAGG + Intergenic
1069199942 10:65600930-65600952 GACAATTATTTTGTTTAAGAAGG + Intergenic
1069242540 10:66161490-66161512 GATAATTGTTTTGTTCAAGAAGG + Intronic
1069325459 10:67226573-67226595 GATAATTGTTTTGTTTGACAAGG - Intronic
1069648293 10:70021067-70021089 GAAAATTATTTTGTTTAAGAAGG - Intergenic
1070441005 10:76443229-76443251 CATATTTGTTTGGTTTAAGGGGG + Intronic
1070465083 10:76713174-76713196 GTTAATTGTTTGGTTTAAGGAGG - Intergenic
1071015714 10:80995368-80995390 GATAATTCTTTTGTTTAAAGAGG + Intergenic
1071405650 10:85328666-85328688 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1071744885 10:88406015-88406037 GATAATTGTTTTGTTTGAGGAGG + Intronic
1071761454 10:88612116-88612138 GATAATTGTTTTGTGTAAGGAGG - Intergenic
1071910805 10:90230705-90230727 GGTAATTGTTTTGTCTGAGGGGG - Intergenic
1071959634 10:90797734-90797756 GATAACTGTTTAATTCAATGAGG + Intronic
1072152501 10:92695021-92695043 ACTAACTGTTTTTTTAAAGGGGG - Exonic
1072815069 10:98499351-98499373 GATAATTGTTTTGTTTCAGGAGG - Intronic
1072871809 10:99127842-99127864 GACAATTATTTTGTTTCAGGAGG - Intronic
1072885398 10:99268150-99268172 GATAATTGTTTCATTTAAGGAGG - Intergenic
1072928147 10:99634994-99635016 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1073701074 10:105927112-105927134 GATAATTCTTTTGTTTAAGGAGG - Intergenic
1073741819 10:106416085-106416107 GATAATTATTTTGTTTAAGGAGG - Intergenic
1073820405 10:107256126-107256148 GATAATTGTTTTGTTTAAGGAGG - Intergenic
1073900305 10:108213726-108213748 GATAATTGTTTTGTTTGAAGAGG + Intergenic
1073923481 10:108485983-108486005 TATAATTGTTTTGTTTAAGGAGG + Intergenic
1073950793 10:108807130-108807152 AGTAACTTTTTTTTTTAAGGTGG + Intergenic
1073960417 10:108920290-108920312 GATGATTGTTTTGTTTGAGGAGG - Intergenic
1074037213 10:109752478-109752500 GATAATTATTTTGTTTAAGGAGG + Intergenic
1074062579 10:109980776-109980798 GACAGGTGTTCTGTTTAAGGAGG + Intergenic
1074297320 10:112202464-112202486 GATAACTGTTAAGTTTAAAAAGG + Intronic
1074321682 10:112409180-112409202 TATCACTGTTTTATTTGAGGAGG - Intronic
1074985649 10:118657344-118657366 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1074986097 10:118661198-118661220 GACAATTGTTTTGTTTCAGGAGG + Intergenic
1075946975 10:126441733-126441755 GATAATTGTTTTATTTGAGGAGG - Intronic
1075982585 10:126754179-126754201 GTTAATTGTTTTGTATGAGGAGG + Intergenic
1076206143 10:128604997-128605019 GAGAAATGTTTTGTGAAAGGAGG + Intergenic
1076376043 10:129985844-129985866 GATAATTGTTTTGATTAAGGAGG - Intergenic
1076977667 11:187378-187400 GAACACTGTGTTGTGTAAGGCGG - Intronic
1077774962 11:5260230-5260252 GATAATTGTTTTGTTTAAGAAGG - Intronic
1077834070 11:5908878-5908900 GATAATTGCTTTGTTTAAAGAGG + Intronic
1078288765 11:9984779-9984801 GATAATTGTTTCGTTTGAGGAGG - Intronic
1078687235 11:13544897-13544919 GACAATTATTTTGTTTAAGGAGG + Intergenic
1078706746 11:13750846-13750868 GATAGTTGTTTTGTTTGAGGAGG - Intergenic
1079207935 11:18433589-18433611 GATAATTGTTTTGTTTGAGGAGG + Intronic
1079255834 11:18829015-18829037 GATAATTGCTTTGTATAAGGAGG + Intergenic
1079270935 11:18985421-18985443 GGTAATGGTTTTGTTTAAGGAGG + Intergenic
1079273497 11:19011867-19011889 GATAATTGTTTTGTTTGAAGAGG + Intergenic
1079627358 11:22632341-22632363 GATAGTTATTCTGTTTAAGGAGG + Intronic
1079805860 11:24930514-24930536 GGTAATTGTTTTGTTTAAGGAGG + Intronic
1079952004 11:26817797-26817819 GATAATTCTGTTGTTTGAGGAGG + Intergenic
1080203185 11:29698089-29698111 GACAATTGTTTTGTTTAAGGAGG + Intergenic
1080324290 11:31051674-31051696 AATAACTGTTTTGTTTGAGGAGG - Intronic
1080402468 11:31948739-31948761 GATAATTGTTTTGTTTGAGGAGG - Intronic
1080672374 11:34393366-34393388 GATAATTGTTTTATTTGAGGAGG + Intergenic
1080725920 11:34899610-34899632 GAGATCTGTTTTTTTTAGGGAGG + Intronic
1080863923 11:36176606-36176628 GATAATTGTTTTGTTTAATCAGG + Intronic
1080923537 11:36732513-36732535 GATAATTGTGTTGTTTAAGGAGG - Intergenic
1081090919 11:38865721-38865743 GATAATTGTTTTGTTTAAAGAGG + Intergenic
1081195428 11:40154132-40154154 GATAATTGTTTTGTTTGAGAAGG - Intronic
1081326522 11:41752528-41752550 GATAATTGTTTTTTTTAAGGAGG + Intergenic
1081516337 11:43834008-43834030 CATAACTGTATTGCTTAAGGTGG + Intronic
1081645186 11:44785478-44785500 GATAACTTTTTTGTACGAGGGGG - Intronic
1082104097 11:48201232-48201254 GATAATTATTTTGTTTAAGGAGG - Intergenic
1082120269 11:48372553-48372575 GATAGTTTTTTTTTTTAAGGGGG + Intergenic
1082140347 11:48601980-48602002 GATAATTGTTTTGTTTGGGGAGG + Intergenic
1082567513 11:54698949-54698971 GATAATTGTTTTCTTTGGGGAGG + Intergenic
1083064413 11:59909645-59909667 GATGATTGTTTTGTTTGAGGAGG + Intergenic
1083453309 11:62761392-62761414 GACAACTTTTTTTTTTGAGGCGG - Intergenic
1083528381 11:63394516-63394538 GATAATTGTTTTGTTTGAGGAGG + Intronic
1085240366 11:75048737-75048759 GATACTTGTTTTGTTTAAGGAGG + Intergenic
1085246310 11:75104344-75104366 GATAAAATTTTTGTTTAAGGTGG - Intronic
1085748032 11:79131378-79131400 GATAATTGTTTTGTTTGAGGAGG - Intronic
1085917328 11:80904848-80904870 GATAATTGTTTTGTTTGAAGAGG - Intergenic
1086217699 11:84403580-84403602 TATAGCTGTTTTTTTTAGGGAGG - Intronic
1086264753 11:84984330-84984352 GATAATTGTTTTATTTAAGGAGG - Intronic
1086297767 11:85389708-85389730 GATAATTGTTTTGTTTGTGGAGG - Intronic
1086300480 11:85421978-85422000 GATTATTGTTTTATTTGAGGAGG + Intronic
1086666260 11:89487265-89487287 TACAAATGTTTTGTTTAAGCTGG - Intronic
1086844586 11:91732430-91732452 GATAATTGTTTTATTTAACTAGG - Intergenic
1086864367 11:91961464-91961486 GATAATTATTTTGTTTAAGGAGG - Intergenic
1086869206 11:92016759-92016781 GATAATTATTTTCTTTAAGGAGG + Intergenic
1086876248 11:92099063-92099085 GATAAAAGTTTTGTTTAATGAGG + Intergenic
1087602222 11:100330675-100330697 GATAATTGTTTTGTTTAAGGAGG - Intronic
1087610136 11:100424066-100424088 GATAATTGTTTTGTTTAAGGAGG - Intergenic
1087616095 11:100488116-100488138 GATAATTGTTTTGTTTAAGGAGG - Intergenic
1087688778 11:101296103-101296125 GATAATTTTTTTTTTTAAGGAGG + Intergenic
1087817400 11:102674796-102674818 GATAATTGTTTTGTTTCAGGAGG + Intergenic
1087907858 11:103720257-103720279 GATCATTGTTTTGTTTAAGGAGG - Intergenic
1088176148 11:107054806-107054828 GACAATTATTTTGCTTAAGGAGG - Intergenic
1088206594 11:107398883-107398905 GATAAATGTTTTGTTTGAGGAGG - Intronic
1088221524 11:107575159-107575181 GAAAAATGTTTTGTTAAAGTGGG + Intergenic
1088239805 11:107761430-107761452 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1088372295 11:109105156-109105178 GATAATTGTTTTGTTGAAGGAGG + Intergenic
1088387886 11:109280247-109280269 GATAATTGTTTTCTTTGAGGAGG + Intergenic
1088413625 11:109565643-109565665 AATAATTGTTTTGTTTAAGGAGG + Intergenic
1088951323 11:114573061-114573083 GATAATTTTTTTGTTTAAGGAGG - Intronic
1089107555 11:116025469-116025491 GATAATTGTTTTGTTTGAAGAGG - Intergenic
1089826081 11:121279386-121279408 AATAATTGTTTTGATTGAGGAGG + Intergenic
1089837119 11:121380572-121380594 GATAATTGTTCTGTTTAAGGAGG - Intergenic
1089900264 11:121975125-121975147 GATAATTGTTCTGTTTGAGGAGG - Intergenic
1089952728 11:122545281-122545303 GATAATTGTTTTGCTTGAGGAGG + Intergenic
1090682845 11:129079447-129079469 GATAATTGTTTTGTTTCAGGAGG - Intronic
1090688393 11:129150566-129150588 GACAAATATTTTGTTTAAGGGGG - Intronic
1090756873 11:129799605-129799627 GAAAATTATTTTGTTTCAGGAGG - Intergenic
1090894843 11:130963014-130963036 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1091380953 12:58774-58796 GATAATTATTTTGTTTAAGGAGG - Intergenic
1092303723 12:7278358-7278380 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1092700141 12:11219290-11219312 GATAATTGTTTTGTTTAAGGAGG - Intergenic
1092884855 12:12916064-12916086 GATAGCTGTTCTGTTTAAGTAGG + Exonic
1093001868 12:14006402-14006424 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1093010697 12:14103349-14103371 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1093105051 12:15076093-15076115 GGTAATTGTTTTGTTTGAGGAGG - Intergenic
1093172757 12:15877396-15877418 GATAATTGTTTTGTTTGAGGAGG - Intronic
1093241637 12:16684106-16684128 GATATCTGCTTTGATTAAGGTGG - Intergenic
1093290941 12:17321313-17321335 GATAATTGTTTTCCTTAAGGAGG + Intergenic
1093389768 12:18603720-18603742 GATAATTGTTTTGTTTTAGGAGG - Intronic
1093409050 12:18843552-18843574 GACAATTGTTCTGTTTGAGGAGG + Intergenic
1093488542 12:19679946-19679968 GATAATTGTTTCGTTTGAGGAGG + Intronic
1093604343 12:21072332-21072354 GATAACTTTCTTGTTTAAGGAGG + Intronic
1093720743 12:22438794-22438816 GATAATTGTTTCGTTTGAGTAGG - Intergenic
1093948537 12:25137232-25137254 GATAATTATTTTGTTTAAGGAGG - Intronic
1093963925 12:25304879-25304901 GATAATTATTTTGTTTAAGGAGG - Intergenic
1093991595 12:25594412-25594434 GATAATTGTTTTGTTTGAGGAGG - Intronic
1094263280 12:28526396-28526418 GATAATTGTTTTGTTTGAGGAGG + Intronic
1094362292 12:29642441-29642463 GATAATTGTTTTGTTTGAGGAGG - Intronic
1094447194 12:30544813-30544835 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1094717909 12:33031971-33031993 GACAATTGTTTTGTTTGAGGAGG + Intergenic
1094721855 12:33073969-33073991 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1094802291 12:34050218-34050240 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1094808717 12:34116337-34116359 GATGATTGTTTTGTTTGAGGAGG - Intergenic
1095115455 12:38346254-38346276 GATAATTGTTTTGTTTGACAAGG - Intergenic
1095118072 12:38380439-38380461 GATAATTGTTTTGTTTGAGGCGG + Intergenic
1095176445 12:39097311-39097333 TATAATTGTTTTGTTTAAGGAGG - Intergenic
1095665345 12:44790325-44790347 GATAATTGTTTTGTTTGAGGAGG - Intronic
1095725561 12:45447930-45447952 GATAATTATTTTGTTTAAAGAGG - Intergenic
1095732917 12:45524312-45524334 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1095892984 12:47251771-47251793 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1095932229 12:47638501-47638523 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1096151553 12:49316593-49316615 TAAAACTGTTTTGTTTACAGAGG + Intergenic
1096348055 12:50867824-50867846 GATAATTGTTTTGTTTGAGGAGG - Intronic
1096437901 12:51610685-51610707 GATAATTGTTTTGTTTGAGGAGG + Intronic
1096568307 12:52499632-52499654 GAAAACAGTTTTGTTTATTGAGG + Intergenic
1096888423 12:54742285-54742307 GATAATTGTTTTGTTTGAAGAGG + Intergenic
1096956614 12:55532482-55532504 GATAATTATTTTGTTTAAGGAGG - Intergenic
1096957008 12:55536199-55536221 CACAATTGTTTTGTTTGAGGAGG - Intergenic
1097106100 12:56625976-56625998 AATAACTGTTCTCTTTAAAGAGG + Intronic
1097295666 12:57959590-57959612 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1097385794 12:58949023-58949045 GATAATTGCTTTGTTGGAGGAGG + Intergenic
1097547737 12:61025203-61025225 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1097760772 12:63461186-63461208 GATAATTGTTTTATTTGAGGAGG - Intergenic
1097906806 12:64928973-64928995 GACAATTATTTTGCTTAAGGAGG + Intergenic
1098223853 12:68300036-68300058 GATAGGTGTTCTGTTTAAGGAGG - Intronic
1098500767 12:71188905-71188927 GATAATTGTTTTGTTTAAAGAGG - Intronic
1098518788 12:71411053-71411075 GACAATTGTTTTGCTTCAGGAGG - Intronic
1098852411 12:75612451-75612473 GGTAATTGTTTTGTTTAAGGAGG - Intergenic
1098960754 12:76737783-76737805 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1098982509 12:76972859-76972881 GATAATTGTTCTATTTGAGGAGG + Intergenic
1099042146 12:77668998-77669020 GATAATTGTTTCGTTTAAGGAGG - Intergenic
1099269289 12:80487220-80487242 GATTTCTGTTTTGTTTTATGGGG - Intronic
1099332333 12:81305340-81305362 AATAAATGTTTACTTTAAGGAGG - Intronic
1099472877 12:83073269-83073291 GATAATTGTTTTGTTTGAGGAGG + Intronic
1099476984 12:83120444-83120466 GAGAATTGTTTTGTTTGAGGAGG + Intronic
1099844603 12:88013836-88013858 GAGAACTGTTTGGTTTTTGGTGG + Intronic
1100203422 12:92324037-92324059 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1100669365 12:96794028-96794050 GACAATTGTTTTGTTTAAGGAGG + Intronic
1100697079 12:97106618-97106640 GGTAATTGGTTTGTTTGAGGAGG + Intergenic
1100706473 12:97205204-97205226 GATAATTGTTTTGTTTAAGGAGG - Intergenic
1100918706 12:99457108-99457130 GATAATTGTTTTATTTAAGGAGG - Intronic
1100951483 12:99854746-99854768 GTTAATTGTTTTGATTAAGGAGG - Intronic
1101290556 12:103363197-103363219 GATAATTGTTTTGTTTAGGGAGG - Intronic
1101298025 12:103446213-103446235 GATAATTGCTTTGTTTAAGGAGG - Intronic
1101635100 12:106534095-106534117 GATAATCGTTTTGTTTGAGGAGG + Intronic
1102611306 12:114114835-114114857 GACAATTATTTTGTTTCAGGAGG + Intergenic
1102916560 12:116758651-116758673 AATCATTGTTTTGTTTGAGGAGG + Intronic
1103760693 12:123248256-123248278 GATAATTGTTTTGTTTGAGGAGG + Intronic
1103893265 12:124255677-124255699 GATAACTGTTTTAGTTCAGTGGG + Intronic
1104504330 12:129317434-129317456 GATAATTATTTTGTTTGAGGAGG + Intronic
1104741577 12:131179134-131179156 GACAGCTATTCTGTTTAAGGAGG - Intergenic
1105598700 13:21865766-21865788 GATAATTGTCTTGTTTAAGGAGG + Intergenic
1106392078 13:29344949-29344971 GACAATTGTTTTGTTTAAGGAGG + Intronic
1106937986 13:34745881-34745903 GATAATTGTTTTGTTTGAGAAGG + Intergenic
1106977975 13:35245577-35245599 GATAATTGTTTTGTTTAAGGAGG + Intronic
1107497750 13:40945172-40945194 GATATCTATTTTTTTTAAGCTGG - Intronic
1107701881 13:43056900-43056922 GAAAATTGTTTTGTTTAAGGAGG + Intronic
1107755815 13:43621544-43621566 GATAATTGTTTTGTTTGAGAAGG + Intronic
1108215133 13:48176548-48176570 GAAAACTTTTTTTTTTGAGGCGG + Intergenic
1108275182 13:48801204-48801226 GCTAAATGTTATTTTTAAGGTGG + Intergenic
1108298564 13:49051464-49051486 GATAATTGTTTTGTTTAAGGAGG + Intronic
1108469612 13:50754981-50755003 GAAAATTGTTTTGCTTGAGGAGG + Intronic
1108791623 13:53975345-53975367 GACAATTATTCTGTTTAAGGAGG - Intergenic
1108817254 13:54306746-54306768 GATAATTGTCTTGTTTGAGGAGG - Intergenic
1108831816 13:54488423-54488445 GATAATTCTTTCATTTAAGGAGG - Intergenic
1109047728 13:57435790-57435812 GATAATTGTTTTATTTGAGTAGG + Intergenic
1109058157 13:57579665-57579687 GATAATTATTTTGTTTCAAGAGG + Intergenic
1109125277 13:58509811-58509833 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1109201179 13:59433484-59433506 GATAATTGTTGTGTTTAAGGAGG + Intergenic
1109213412 13:59561683-59561705 GATAATTGCTTTCTTTGAGGAGG + Intergenic
1109484728 13:63003404-63003426 GGTAATTGTTCTGTTTAAGGAGG - Intergenic
1109584851 13:64386446-64386468 GAAAACTGTTTGGTTTATGAGGG - Intergenic
1109945439 13:69425479-69425501 GACAATTGTTTTGTTTAAGGAGG - Intergenic
1109975800 13:69829799-69829821 GATAATTGTTTTGTTTAAGGAGG - Intronic
1110182002 13:72627841-72627863 GATAATTGTTTTGTTTAAGGAGG - Intergenic
1110196969 13:72800678-72800700 GATTACTGTTTTGTTTAACAAGG - Intronic
1110340762 13:74387542-74387564 GACAGTTGTTTTGTTTAAGTAGG + Intergenic
1110562043 13:76919453-76919475 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1110627736 13:77669913-77669935 GATAATTGTTGTATTTGAGGAGG - Intergenic
1110748239 13:79080921-79080943 GATAATGGTTTTGTTTGAGGAGG - Intergenic
1110793495 13:79611535-79611557 GATAATTGTTTTGTCTGAGGAGG + Intergenic
1110852459 13:80261301-80261323 GATAGTTGCTTTGTTTGAGGAGG + Intergenic
1111148641 13:84218253-84218275 GGTAATCGTTTTGTTTTAGGAGG - Intergenic
1111165592 13:84454145-84454167 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1111225759 13:85268325-85268347 GATAATTGTTTTGATTAAGGAGG - Intergenic
1111283153 13:86053076-86053098 GATAATTGTTTTGTTTAAGGAGG - Intergenic
1111988612 13:95091495-95091517 GATCATTGTTTTGTTTGAGGAGG - Intronic
1112738254 13:102444845-102444867 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1112747477 13:102542899-102542921 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1112873595 13:104006663-104006685 GATGACTCTATTGTTTCAGGAGG - Intergenic
1112945493 13:104921672-104921694 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1113240457 13:108330661-108330683 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1113269780 13:108661075-108661097 GATAATTGTTTTGCTTGAGGAGG + Intronic
1113534866 13:111058117-111058139 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1113637992 13:111935151-111935173 AATAAGTGTTTTGTTTAAGGAGG + Intergenic
1113845465 13:113387106-113387128 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1114030621 14:18576667-18576689 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1115299428 14:31866999-31867021 GATAATTGTTTTGTTCGAGGAGG - Intergenic
1115350471 14:32389637-32389659 GATAATTGTTTTGTCTGAGGAGG + Intronic
1115393058 14:32875933-32875955 GATAATTGTTGTGTTTAAGGAGG + Intergenic
1115680482 14:35732084-35732106 GATAATTGTTTTGTTTGAGGAGG - Intronic
1115835316 14:37396266-37396288 GATAATTGTTTTGTTTGAGGAGG + Intronic
1115969965 14:38933902-38933924 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1115997158 14:39206079-39206101 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1116026866 14:39525850-39525872 GATAATTCTTTTCTTTAAGAAGG + Intergenic
1116044718 14:39730757-39730779 CATAGTTGTTTTGTTTAAGAAGG + Intergenic
1116048872 14:39779796-39779818 GATAATTCTTTTGTTTGAGGAGG + Intergenic
1116064045 14:39959799-39959821 GATAATTGTTTTGTTTATGGAGG - Intergenic
1116088829 14:40278003-40278025 GATATTTGCTTTGTTTGAGGAGG + Intergenic
1116335672 14:43652957-43652979 GCTAATTGTTTTGTTTGAGGAGG - Intergenic
1116668881 14:47815994-47816016 GATAATTGTTTTGTTTAAGGGGG + Intergenic
1116732161 14:48637508-48637530 GATTATTGTTTTGTTTGAGGAGG - Intergenic
1116845465 14:49861183-49861205 GATACCTGTTTTATTCAAAGAGG + Intergenic
1117103632 14:52376938-52376960 AATAATTGTTTTGTTTAGGGAGG + Intergenic
1117112933 14:52477024-52477046 GATAATTGTTTTGTTTGAAGAGG - Intronic
1117271530 14:54148434-54148456 GATCATTGTTTTGTTTAAGGAGG - Intergenic
1117509960 14:56441404-56441426 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1117655250 14:57949818-57949840 GACAATTATTTTGTTTAAGGAGG + Intronic
1117768695 14:59109515-59109537 GATAATTGTTTTGTCTGAGGAGG - Intergenic
1118140036 14:63070916-63070938 GATAATTATTTTGTTTAAGGAGG + Intronic
1118162468 14:63303512-63303534 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1118169649 14:63375420-63375442 GATAAAAGTTTTGTTTACTGGGG - Exonic
1118526353 14:66648953-66648975 GATAACTGTTCTGATTCAGAGGG + Intronic
1118531946 14:66716806-66716828 GAGAATTGTTTTGTTTGAGGAGG + Intronic
1119098638 14:71857779-71857801 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1119582505 14:75799758-75799780 GATAATTGTTTTGTTTAAGGAGG + Intronic
1120400178 14:84021559-84021581 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1120450762 14:84664524-84664546 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1120489754 14:85162345-85162367 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1120545599 14:85807946-85807968 GATAATTATTTTCTTTGAGGAGG + Intergenic
1120736194 14:88056045-88056067 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1120785433 14:88530126-88530148 GATAATTGTTTTGTTTAAGGAGG - Intronic
1121460035 14:94067684-94067706 GAAGATTGTTTTGTTTGAGGAGG - Intronic
1121503305 14:94457314-94457336 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1121516412 14:94554987-94555009 GAAAATTGTTTTGTTTGAGAAGG + Intergenic
1121575611 14:94983046-94983068 GATAATTGTTTTGTTTAAGGAGG - Intergenic
1121848272 14:97195020-97195042 GATAATTGTTTTGCTTAAGGAGG + Intergenic
1123104058 14:105829205-105829227 GATAATTGTTCTGTTGGAGGAGG - Intergenic
1124225313 15:27888321-27888343 AATAACTGTTTTATTTCAGCAGG - Intronic
1124380900 15:29164015-29164037 GATAATCGTTTTGTTTGAGGAGG - Intronic
1124386836 15:29216258-29216280 GATAATTGTTTTGTTTCAAGAGG + Intronic
1124505189 15:30266448-30266470 GATAATTGTTTTGTTCAAGGAGG - Intergenic
1124738363 15:32272187-32272209 GATAATTGTTTTGTTCAAGGAGG + Intergenic
1125269238 15:37920255-37920277 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1125988317 15:44078163-44078185 GATAACTGTTTTTTCAAATGTGG + Intronic
1126190729 15:45875176-45875198 GATAATTGTTTTGTTTAAGGAGG - Intergenic
1126460601 15:48911888-48911910 GATAATTGTTTTGTTTGAGGAGG + Intronic
1126521214 15:49596310-49596332 GATAATAATTTTGTTTAAGGAGG - Intronic
1126591276 15:50342568-50342590 GTTCAGTGTTTTGTTTAAGTGGG + Intronic
1126595035 15:50376424-50376446 GATAGCTTTTTTTTTTGAGGCGG - Intergenic
1126836927 15:52677984-52678006 GGTAAATGATTTGTTTAAGTAGG - Intronic
1126977462 15:54199540-54199562 TATAATTGTTTTTTTTAAGGAGG - Intronic
1127008035 15:54593099-54593121 AATAATTGTTTTATTTGAGGAGG + Intronic
1127090212 15:55459205-55459227 GATAATTATTTTGTTTAAGGAGG - Intronic
1127573803 15:60270968-60270990 GATCATTGTTTTGTTTAAGGAGG + Intergenic
1127942950 15:63719227-63719249 GATTACTATTTTATATAAGGTGG + Intronic
1128238911 15:66086510-66086532 GATAATTGTTTTGTCTGAGGAGG - Intronic
1128415188 15:67438248-67438270 GATAATTGTTTTGTTTGAGGAGG - Intronic
1129097427 15:73224092-73224114 GATAATTGTTATGTTTGAGGAGG + Intronic
1129631871 15:77268863-77268885 GATAATTATTTTGTTTAAGGAGG - Intronic
1129928917 15:79392396-79392418 GATAATTTTTTTGTTTCAAGAGG + Intronic
1130077638 15:80703364-80703386 GTGAAGTGTCTTGTTTAAGGGGG - Intronic
1130749597 15:86696890-86696912 GATAATTGTTTTGTTTAAGGAGG + Intronic
1131413944 15:92235032-92235054 GACAATTATTCTGTTTAAGGAGG - Intergenic
1131574838 15:93577865-93577887 GAAAACTATTTTGTTTCAGTAGG - Intergenic
1131869947 15:96753503-96753525 GGTAATCTTTTTGTTTAAGGAGG - Intergenic
1132041476 15:98528133-98528155 TTTAACTTTTTTTTTTAAGGAGG + Intergenic
1132210120 15:100015658-100015680 GATAATTGTTTTGTTTGAGGAGG + Intronic
1132253883 15:100356953-100356975 GATAATTGTTTTGTTTAAGGAGG - Intergenic
1132412680 15:101596157-101596179 GATAATTTTTTTGTTTAAGGAGG + Intergenic
1134032181 16:11001027-11001049 GAAAATTGATTTGTTTAGGGCGG - Intronic
1134183424 16:12065120-12065142 GATAACTCTGTGGTTTAGGGAGG + Intronic
1134805843 16:17124408-17124430 GGTAACTGTTTTGTTTAAGGAGG + Intronic
1135289257 16:21221006-21221028 GATAATTATTTTGTTTAAGAAGG + Intergenic
1135673425 16:24393994-24394016 GATAACTTTTTTTTTTGAGATGG + Intergenic
1135901811 16:26466586-26466608 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1136735806 16:32466530-32466552 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1137550021 16:49431165-49431187 GGTAAATGTTTTGTTTAGAGTGG - Intergenic
1138192279 16:55023656-55023678 GACAATTGATTTGTTTAAGGAGG - Intergenic
1140447151 16:75039274-75039296 GAAAACTTTTTTTTTTAATGTGG + Intronic
1140530932 16:75665334-75665356 GATAATTGTTTTGTTTAAGGAGG - Intronic
1141965101 16:87436786-87436808 GATGACAGTTTTGTTTAAAATGG + Intronic
1142103657 16:88290422-88290444 GATAACAGATCTGCTTAAGGAGG - Intergenic
1142442661 16:90109947-90109969 GAACACTGTGTTGTGTAAGGCGG + Intergenic
1203017269 16_KI270728v1_random:363044-363066 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1203035604 16_KI270728v1_random:636202-636224 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1142465086 17:131843-131865 GAACACTGTGTTGTGTAAGGCGG - Intergenic
1142840996 17:2630401-2630423 GATAATTGTTTTGTTTGAGGAGG + Intronic
1142910625 17:3087797-3087819 GGTAATTGTTTTGTTTAAGGAGG + Intergenic
1143990998 17:10961271-10961293 GATAATTGTTTTATTTGAGGAGG - Intergenic
1144116144 17:12093019-12093041 GCTAACTTTTTTTTTTAAGACGG - Intronic
1144278196 17:13697804-13697826 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1144537069 17:16100938-16100960 GATAACTGTTGTGCCTGAGGAGG - Intronic
1146583565 17:34061197-34061219 GATAATGGTTTTGTTTGAGGAGG - Intronic
1146612959 17:34324404-34324426 GATAATTGTTTTGTTTAAGGGGG + Intergenic
1147463019 17:40587716-40587738 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1147970026 17:44214298-44214320 TAAAACTGTTTTGTCTGAGGAGG - Intronic
1148400412 17:47355170-47355192 GATAATTGTTTTGTTTAAGGAGG + Intronic
1148408077 17:47438073-47438095 GATAATTGTTTTGTTTGAAGAGG + Intronic
1149122228 17:53183666-53183688 GATCATTGTTTTGTTTAAGGAGG + Intergenic
1149221562 17:54420029-54420051 GGTAATTGTTTTGTTTAAGGAGG - Intergenic
1149245309 17:54698679-54698701 GACAACAGTCTTTTTTAAGGAGG + Intergenic
1149410728 17:56403956-56403978 GATAATTGTTTTGCTTGAGAAGG + Intronic
1150539212 17:66078916-66078938 GATAATTGTTTTGTTTGAGGAGG + Intronic
1150818600 17:68416309-68416331 GATAATTGTTTTGATGGAGGAGG + Intronic
1150945311 17:69739823-69739845 GATAACTGTTTTGTTTGAAGAGG + Intergenic
1151048557 17:70949297-70949319 GACAATTGTTTTGTTTGAGGAGG - Intergenic
1151078969 17:71306125-71306147 GATCATTGTTTTGCTTAAAGAGG - Intergenic
1152953885 18:18985-19007 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1153069318 18:1087850-1087872 GATAATTGTTTTGTTTGAAGAGG + Intergenic
1153071764 18:1114490-1114512 GATAATTGTTTTTTTTAAGGAGG + Intergenic
1153079749 18:1209042-1209064 GATAATTGTTTTTTTAAAGGAGG + Intergenic
1153164442 18:2245810-2245832 GATAATTGTTTCATTTGAGGAGG - Intergenic
1153396227 18:4624482-4624504 GATAATTGTTTTCTTTAAGGAGG + Intergenic
1153828927 18:8902535-8902557 GGCAATTGTTTTGTTTGAGGAGG - Intergenic
1153965761 18:10180733-10180755 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1154090169 18:11350920-11350942 GATAATTGTTTTGTTTAAGGAGG - Intergenic
1154298045 18:13167380-13167402 GATAATTCTTTTGTTTAAGGAGG - Intergenic
1155004514 18:21716213-21716235 GATAATTGTTTTGTTTAGAGAGG - Intronic
1155573660 18:27222449-27222471 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1155886923 18:31219141-31219163 GATAGTTATTTTGTTTGAGGAGG - Intergenic
1156011150 18:32499671-32499693 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1156051482 18:32940802-32940824 GATCAATGTTTTGCATAAGGGGG - Intronic
1156344597 18:36245418-36245440 GATAATTATTTTGTTTAAGGAGG + Intronic
1156642674 18:39121062-39121084 GATAATTATTTTGTTTAAGGAGG - Intergenic
1156893200 18:42214056-42214078 GATCATTGTTTTGTTTAAGGAGG + Intergenic
1157072569 18:44425238-44425260 GATAAATGTTTTCTTAAATGTGG + Intergenic
1157218760 18:45808577-45808599 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1157703120 18:49777830-49777852 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1158002792 18:52638016-52638038 GATAATTGTTTTGTTTGAGGAGG - Intronic
1158097809 18:53794192-53794214 GATAATTGTTTTGTTTAAGGAGG - Intergenic
1158240439 18:55371365-55371387 GTTAAGTGTCTTGTCTAAGGAGG - Intronic
1158421032 18:57294513-57294535 AATAACTTTTTTTTTTAAGGTGG - Intergenic
1158756671 18:60333268-60333290 GATAATTCTTTTGTTTGAGGAGG - Intergenic
1158829995 18:61265983-61266005 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1159428615 18:68321845-68321867 AATAAATGTTTTCTCTAAGGAGG + Intergenic
1159612742 18:70544863-70544885 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1159906761 18:74099274-74099296 GATAGTTGTTTTGTTTAAGGAGG - Intronic
1160059000 18:75512525-75512547 GACAATTATTTTGTTTAAGGAGG - Intergenic
1160267451 18:77352563-77352585 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1163886394 19:19969211-19969233 GATACTTGTTCTGTTTAAGGAGG + Intergenic
1163888035 19:19985873-19985895 GATACTTGTTCTGTTTAAGGAGG - Intergenic
1163949940 19:20574787-20574809 GATACTTGTCTTGTTTAAGGAGG + Intronic
1163968065 19:20766601-20766623 GATGCTTGTCTTGTTTAAGGAGG - Intronic
1164010499 19:21199318-21199340 AATAAGTGTTTTGTTGATGGGGG + Intergenic
1164018193 19:21271889-21271911 GATAGTTGGTTTGCTTAAGGAGG + Intronic
1164251878 19:23484518-23484540 CATAATTGTTTTGTTTGAGGAGG - Intergenic
1164263413 19:23590103-23590125 GATAATTATTTTGTTTAAGGAGG - Intronic
1164320018 19:24136086-24136108 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1165805343 19:38577409-38577431 AATCACTGTTTTGTTTAACACGG - Intronic
1166604083 19:44125326-44125348 GATAATTGTTTTGTTTAAGGAGG + Intronic
1167669608 19:50842617-50842639 GATAATTGTTTTGTATAAGGAGG + Intergenic
1168458249 19:56532418-56532440 GATAATTGTTTTGTTTGAGGAGG + Intergenic
924992684 2:327328-327350 GATAATTGTTTTGTTTAAGGAGG + Intergenic
925127303 2:1468498-1468520 GATAATTGTTTTGTCTGAGGAGG + Intronic
925441755 2:3893899-3893921 GATACTTGTTTTGTTTAAGGAGG + Intergenic
925652119 2:6102406-6102428 GATAATTGTTTTGTTTAAGGAGG + Intergenic
925795527 2:7538274-7538296 GATAATTGTTTTGTTTAAGGAGG + Intergenic
926560348 2:14409854-14409876 GATAATTGTTTTGTTTGAGGAGG - Intergenic
926706752 2:15842832-15842854 GAGATCTGATTTGATTAAGGAGG + Intergenic
927069782 2:19515749-19515771 GATAATTATTTTATTTAAGGAGG + Intergenic
927071751 2:19537801-19537823 GAGAATTGTTTTGTTTAAGGAGG - Intergenic
927080121 2:19618933-19618955 GATAATTGCTTCCTTTAAGGAGG - Intergenic
927328175 2:21831130-21831152 GATAATTGTTTCGTTTGAGGAGG + Intergenic
927536390 2:23863954-23863976 AATGTCTGTTTTCTTTAAGGAGG - Intronic
928351937 2:30565810-30565832 GGGTGCTGTTTTGTTTAAGGTGG + Intronic
928443061 2:31309838-31309860 GCTAATTGTTTCGTTTAACGAGG + Intergenic
928473131 2:31593894-31593916 GATAGTTATTTTGTTTAAGGAGG - Intergenic
928539218 2:32268731-32268753 GATAACTGTGTTATTTGCGGAGG + Intergenic
928772349 2:34718259-34718281 GATAATTGTTTTGTTTGAGGAGG + Intergenic
928856137 2:35804506-35804528 GATAATTGTTTTGTTTGAGGAGG - Intergenic
929010111 2:37433677-37433699 GATAATTGTTTTGTTTGAGGAGG + Intergenic
929197264 2:39197687-39197709 GATAATTGTTTTGTTTAAGGAGG - Intronic
929823899 2:45295235-45295257 GATAACTCTTTTGTCTCTGGAGG - Intergenic
930423121 2:51178348-51178370 GATAGTTGTTTTGTTCAAGGAGG - Intergenic
930486344 2:52016406-52016428 GATAATTGTTTCGTTTGAGGAGG + Intergenic
930574140 2:53125886-53125908 GATAATTGTTTTATTCAAGGAGG + Intergenic
931388039 2:61814886-61814908 GATAACTGTATTTCTTAAGAAGG - Intergenic
931524995 2:63143731-63143753 GATAATTGTTTTGTTTGAGGAGG + Intronic
931535979 2:63277076-63277098 GATAATTGCTTTGTTTAAGGAGG - Intronic
931548041 2:63410217-63410239 GATAATTGTTTTGTTCAAGGAGG - Intronic
931834798 2:66087136-66087158 GATAATTGTTTTGTTTAAGGAGG - Intergenic
932100441 2:68894899-68894921 GATGATTGTTTTGTTTGAGGAGG + Intergenic
932270475 2:70404410-70404432 GATAATCGTTTTGTTTGAGGAGG - Intergenic
932384735 2:71321955-71321977 GATAATTGTTTTGTTTGAGGAGG + Intronic
932915238 2:75850597-75850619 GATATTTTTTTTTTTTAAGGCGG - Intergenic
932954478 2:76335955-76335977 GGTAATTGTTTTGTTTGAGGAGG + Intergenic
933340808 2:81024127-81024149 GACAATTTTTTTGTTTAAGGAGG + Intergenic
933382237 2:81563660-81563682 AATAATTGTTTTGTTTAAGGAGG + Intergenic
933398077 2:81756655-81756677 CATCATTATTTTGTTTAAGGAGG - Intergenic
934003258 2:87736609-87736631 TATAACTTTTTTTTTTAAGATGG - Intergenic
934042301 2:88137814-88137836 GATTACTTTTTTTTTTAATGAGG + Intergenic
934111235 2:88745569-88745591 GATAATTAATTTGTTTAAGGAGG + Intronic
934177574 2:89590131-89590153 GATAATTGTTTTGTTTGAGGAGG + Intergenic
934186971 2:89755636-89755658 GATAATTGTTTTGTTTGAGGAGG + Intergenic
934287871 2:91664432-91664454 GATAATTGTTTTGTTTGAGGAGG + Intergenic
934310018 2:91853533-91853555 GATAATTGTTTTGTTTGAGGAGG - Intergenic
934669952 2:96205404-96205426 CATAGCTGTTTTGGTTAAGCGGG - Intronic
934711602 2:96518706-96518728 GATAACATTTTTGTTTACTGTGG - Intergenic
935002870 2:99038007-99038029 GATAATTGTTTTGTTTAAGGAGG - Intronic
935007287 2:99091123-99091145 GACAATTGTTTTGTTTAAGGAGG - Intronic
935304387 2:101722722-101722744 GATACCTGTGTTGTTTTTGGAGG + Intronic
935837223 2:107068105-107068127 GTTCCCTGTTTTGTTTGAGGAGG - Intergenic
936141056 2:109940600-109940622 GACAATTATTTTGTTTCAGGAGG - Intergenic
936164617 2:110108890-110108912 GATAATTGTTTTGTTTGAGGAGG - Intronic
936177744 2:110238545-110238567 GACAATTATTTTGTTTCAGGAGG - Intergenic
936203637 2:110430886-110430908 GACAATTATTTTGTTTCAGGAGG + Intronic
936555076 2:113489206-113489228 GATAATTGTTTTGTTTGAGGAGG - Intronic
936624522 2:114134236-114134258 GATAACTTTTTCATTTAATGTGG + Intergenic
936857852 2:116981748-116981770 AATAATTATTTTGTTTAAGGAGG - Intergenic
936899141 2:117464725-117464747 GATAATTGTTTTGCTTAAAGAGG + Intergenic
936911172 2:117595527-117595549 GATAATTGTTTTGTTTGAGGGGG + Intergenic
937058036 2:118955802-118955824 GATAATTGTTTTGCTTGAGGAGG - Intronic
937069077 2:119048948-119048970 GATAATTGTTTTGTGTGAGGAGG + Intergenic
937461344 2:122090299-122090321 GACAATTACTTTGTTTAAGGAGG + Intergenic
937529435 2:122810048-122810070 GAATAGTGTTTTGTTTGAGGAGG - Intergenic
937722890 2:125124842-125124864 GATAATTGTTTTATTTAAGGAGG + Intergenic
937767462 2:125678765-125678787 GAAAATTGTTTTGTTTGAGGAGG + Intergenic
937798820 2:126057832-126057854 GATAATTGTTTTGCTTAAGGAGG + Intergenic
937971904 2:127556680-127556702 GATAATTGTTTTGTTTAAGGAGG + Intronic
938037905 2:128051815-128051837 GATGATTATTTTGTTTGAGGAGG + Intergenic
938175418 2:129122627-129122649 GATAATTGTTTTGTTTAAGGAGG + Intergenic
938497587 2:131809100-131809122 GATAATTGTTTTGTTTGAGGAGG - Intergenic
938598086 2:132810076-132810098 GATAATTGTTTTGTTTGAAGAGG + Intronic
938599602 2:132823400-132823422 GACAATTATTTTGTTTCAGGAGG - Intronic
939069936 2:137526794-137526816 GATAAATGTTTTGAATAAGAGGG + Intronic
939149666 2:138457851-138457873 GAAAATTGTTTTGTTCAAGGAGG - Intergenic
939219503 2:139283114-139283136 GACAATAGTTTTGTTTAAGGAGG - Intergenic
939245610 2:139619889-139619911 GAAAATTGTTTTGGTTAAGGAGG + Intergenic
939445155 2:142300612-142300634 GTTAACTATTTTGTTTAATTTGG - Intergenic
939769732 2:146300237-146300259 GTTAACTGGTTTGTTTGAAGAGG - Intergenic
940034534 2:149300359-149300381 GATAATTGTTTTGTTTGAGGAGG + Intergenic
940156974 2:150667354-150667376 GCTAATTGTTTTGTTTGAGGAGG - Intergenic
940217793 2:151317831-151317853 GATAATTGTTTTATTTAAGGAGG - Intergenic
940423527 2:153506631-153506653 GATAATTGTTTTGTTTAAGGAGG + Intergenic
940618513 2:156082424-156082446 GATAATTGTTTTGTTTGAGGAGG + Intergenic
940630486 2:156231559-156231581 GAAAATTATTTTGCTTAAGGAGG - Intergenic
940709231 2:157142634-157142656 GATAATTGTTTTGTTTGAGGAGG + Intergenic
940762519 2:157752644-157752666 CATAATTGTTTTGTTTAAGGAGG - Intronic
940834155 2:158501655-158501677 GTTAAGTGTTTTGTTGAAGAGGG + Intronic
941402036 2:165043298-165043320 GATAATTGTTTTGTTTAAGAAGG + Intergenic
941627610 2:167846448-167846470 GATAATTGTTTTGTTTGAGGAGG - Intergenic
941679791 2:168384918-168384940 GATAATTGTTTTGTTTGAGGAGG - Intergenic
941738187 2:169003943-169003965 GATAATTGTTTTGGTTAATGAGG + Intronic
942154560 2:173114694-173114716 GATAATTGTTTTGTTTAAGGAGG + Intronic
942469901 2:176249488-176249510 GATAATTGTTTTGTTTGAGGAGG + Intergenic
942726210 2:179010499-179010521 GATAATTGTTTTGTGTGAGGAGG - Intronic
942743794 2:179208572-179208594 GATAATTATTTTGATTAAGGAGG - Intronic
943015525 2:182505572-182505594 GTTAACTGTTTGGTTTAGAGGGG + Intronic
943015669 2:182507392-182507414 GTTAACTGTTTGGTTTAGAGGGG + Intronic
943149838 2:184098145-184098167 GACAATTTTTTTGTTTAAGGAGG + Intergenic
943449209 2:188027303-188027325 GATAATTGTATTGTTTAAGGAGG + Intergenic
943891117 2:193288865-193288887 GATAAGTATTTTATTTGAGGAGG + Intergenic
943909462 2:193544095-193544117 GATAATTGTTTTGTTTAAGGAGG - Intergenic
944431911 2:199643330-199643352 GATAATTGTTTTGTTTGAGGAGG + Intergenic
944485555 2:200201396-200201418 GATAATTGTTTTGTTTAAGGAGG - Intergenic
944602276 2:201314885-201314907 GATAATTGTTTTGTTTAAGGAGG - Intronic
945075335 2:206032668-206032690 GATAATTGTTTTGTTTAAGGAGG - Intronic
945285817 2:208080324-208080346 GATAATTGTTTTGTTTAAGGAGG - Intergenic
945362548 2:208908658-208908680 GATAATTGTTTTGTTTAAGGAGG - Intergenic
945377211 2:209093205-209093227 GATAATTGTTTTGTTTAAGAAGG + Intergenic
945387188 2:209216293-209216315 GCTAACTGTTTTGTTTAAGGAGG - Intergenic
945482416 2:210359461-210359483 GATAATTGTTTTGTTTGAGGAGG + Intergenic
945536384 2:211023665-211023687 GATAATTGTTTTCTTTAAAGAGG + Intergenic
945825920 2:214719439-214719461 AATAATTGTTTTGTTTGAGGAGG - Intergenic
945861498 2:215128087-215128109 GATAATTGTTTTATTTGATGAGG + Intronic
946259794 2:218478381-218478403 GATAAATATTTTGCTGAAGGAGG + Intronic
946501461 2:220251576-220251598 GATAATTGTTTTGTTTGAGGAGG - Intergenic
946620052 2:221552000-221552022 CATTACTGTGTTCTTTAAGGAGG - Intronic
946824163 2:223659090-223659112 GATAATTGTTTTCTTTAGGGAGG - Intergenic
947145854 2:227064735-227064757 GACAGTTGTTCTGTTTAAGGAGG - Intronic
947456894 2:230263762-230263784 GATAATTGTTTTGTTTGAAGAGG + Intronic
947460664 2:230301485-230301507 GATAATTATTTTGTTTAAGGAGG - Intronic
948531362 2:238608103-238608125 GATAATTGTTTTGTTTAAAGAGG - Intergenic
948576893 2:238957997-238958019 GATAATTGTTTTGTTTAAGGAGG - Intergenic
948714202 2:239848786-239848808 GATAATTGTTTTGTTTAAGGAGG - Intergenic
948746438 2:240097637-240097659 GACAGTTGTTCTGTTTAAGGAGG - Intergenic
1169336018 20:4758117-4758139 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1169401492 20:5284348-5284370 GATAATTGTTTCATTTGAGGAGG - Intergenic
1169517271 20:6331661-6331683 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1170086399 20:12536999-12537021 GATAATTGTTTTGTTTAAGGAGG - Intergenic
1170133703 20:13050775-13050797 GATAATTGTTTTGTTTGAGGGGG - Intronic
1170245582 20:14218825-14218847 GATAATTGTTTTGTTTGAGGAGG + Intronic
1170255645 20:14340104-14340126 GATGACTGTTTTGATTGAAGGGG + Intronic
1170375704 20:15698366-15698388 GATAATTGTTTTGTTTAAAGAGG + Intronic
1170489308 20:16856061-16856083 GCTAATTGTTTTGTTTAAGGAGG + Intergenic
1170650911 20:18240387-18240409 GATAATTGTTTTGTTTAAGGAGG - Intergenic
1170720854 20:18877906-18877928 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1170726749 20:18935746-18935768 GATAATCATCTTGTTTAAGGAGG + Intergenic
1170862978 20:20126507-20126529 GATAATTGTTTTGTTTGAGGAGG + Intronic
1171066790 20:22025267-22025289 AATAATTGTCTTGTTTAAGGAGG + Intergenic
1171165775 20:22968904-22968926 GATAATTCTTTTGTTTGAGGAGG - Intergenic
1171198379 20:23221394-23221416 GATAATCATTTTGTTTAAGGAGG + Intergenic
1171242129 20:23579875-23579897 GACAATTATTTTGTTTCAGGAGG + Intergenic
1172796223 20:37540478-37540500 CATAACTGTTTTTGTTAAGTTGG + Intergenic
1172851263 20:37967720-37967742 GATAATTGTTTTGTTTAAGCTGG + Intergenic
1173985946 20:47261531-47261553 GATAACTGTTTTTTTAGAGATGG - Intronic
1174344293 20:49918505-49918527 GTTAACTGTTTTGTAGAGGGAGG + Intergenic
1174828105 20:53787434-53787456 GATAATTTTTTTTTTTGAGGTGG + Intergenic
1175069249 20:56317926-56317948 GATAATTGTTTTGTTTGCGAAGG - Intergenic
1177069444 21:16485259-16485281 GATAATTGTTTTGTTTTAGGAGG + Intergenic
1177174262 21:17687826-17687848 CATAATTGTTTTGTTTGAGGAGG + Intergenic
1177176629 21:17706445-17706467 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1177195353 21:17899105-17899127 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1177330869 21:19660311-19660333 GATAATTGTTTTGTTTAATGGGG - Intergenic
1177364379 21:20115707-20115729 GATAGTTATTTTGTTTAAGGAGG + Intergenic
1177394392 21:20513520-20513542 AATAATTATATTGTTTAAGGAGG + Intergenic
1177579011 21:22994975-22994997 GATAATTATTTTGTTTAAGGAGG + Intergenic
1177681225 21:24374170-24374192 GATAACTGTTTTGTTTAAGGAGG + Intergenic
1177847493 21:26307380-26307402 GATAATTATTTTGTTTGAAGAGG - Intergenic
1178059552 21:28836336-28836358 AATAATTGTTTTGTTTGAGGAGG - Intergenic
1178801847 21:35802752-35802774 GATAATTGTTTTGTTTGAGGAGG - Intronic
1178959218 21:37048714-37048736 GATAATTGTTTTGTTTGAGGCGG - Intergenic
1179083984 21:38201077-38201099 GATAATTGTTTTGTTTGAGGAGG + Intronic
1179198305 21:39187056-39187078 GAAAAATGCTTTTTTTAAGGGGG - Exonic
1179349623 21:40595630-40595652 GATAAGTGTTTTATGTGAGGAGG - Intronic
1179443485 21:41412896-41412918 GATAATTATTTTGTTTAAGGAGG - Intergenic
1179467607 21:41587712-41587734 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1180454735 22:15503723-15503745 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1180536756 22:16399417-16399439 GATAATTGTTTCGTTTGAGGAGG - Intergenic
1182689291 22:32145476-32145498 GATATTTGTTTTCTTTGAGGCGG - Intergenic
1183178526 22:36242463-36242485 AACAATTATTTTGTTTAAGGAGG + Intergenic
949189803 3:1237749-1237771 AATAGTTGTTTTGTTTAAGGAGG - Intronic
949749487 3:7334302-7334324 GATAATTATTTTGTTTAAGGAGG - Intronic
949814433 3:8042490-8042512 GATAATTGTTTTGTTTGAAGAGG - Intergenic
950588059 3:13910553-13910575 GACAATTATTTTGTTTCAGGAGG - Intergenic
950599047 3:14015732-14015754 GATAATTGTTTTGTTTGAGGAGG + Intronic
950812955 3:15667347-15667369 GATGAGTGTCTTGTTAAAGGAGG + Exonic
950820134 3:15748483-15748505 GATAATCGTTTTGTTTAAGGAGG + Intronic
951137443 3:19119782-19119804 GAAAATTGTTTTCTTTAAGAAGG - Intergenic
951153565 3:19322484-19322506 GATAATTGTTTTGTTTTAGGAGG + Intronic
951183964 3:19690168-19690190 GACAATTGTTTTGTTTGAGAAGG - Intergenic
951198337 3:19849111-19849133 GATAATTATTTTGTTTAAGGTGG - Intergenic
951262068 3:20522241-20522263 GATCATTGTTTTGTTTAAAGGGG + Intergenic
951294658 3:20919010-20919032 GATAATTGTTTTGTTTAAGGAGG - Intergenic
951302524 3:21016186-21016208 GATAATTGTTTTGCTTAAGGAGG + Intergenic
951467968 3:23022208-23022230 GATAATTATTTTGTTTAAAGAGG - Intergenic
951572320 3:24077720-24077742 AGTAATTGTTTTGTTTGAGGAGG + Intergenic
951727120 3:25772920-25772942 GATAATTATTTTGTTTAAAGAGG + Intronic
951852078 3:27152342-27152364 GATAATTGTTTAGTTTGAGGAGG - Intronic
952122870 3:30265455-30265477 GATAATTCTTTTGTTTAAGGAGG - Intergenic
952256580 3:31700983-31701005 GCCCACTGTTTTGTTTAAAGTGG + Intronic
952522246 3:34173270-34173292 GATAATTATTTCATTTAAGGAGG + Intergenic
952601668 3:35090415-35090437 GACAATTGTTTTGTTTGAGGAGG - Intergenic
952689683 3:36190756-36190778 GATAATTGTTTTGTTTGAGGAGG + Intergenic
952703391 3:36350096-36350118 GATAATTGTTTTGTCTAATGAGG - Intergenic
952714757 3:36469377-36469399 GATAATTGTTCTGTTTAAGGAGG + Intronic
952732645 3:36654817-36654839 GATAATTGTTTTGTTTAAGGAGG - Intergenic
953185443 3:40633169-40633191 GATAATTATTTTGTTTAAGGAGG - Intergenic
953276874 3:41509674-41509696 GAAAATTATTTTGTTAAAGGAGG - Intronic
953495253 3:43380543-43380565 GCCAATTGTTTTGTTTAAGGAGG - Intronic
953866589 3:46588418-46588440 GATAATTGTTTTGTTTGAAGAGG - Intronic
954252687 3:49380348-49380370 AATGACTGTCTTATTTAAGGTGG + Intronic
955175464 3:56609865-56609887 GATAATTTTTTTGTTTGAGGAGG + Intronic
955450589 3:59063132-59063154 GATAATTGTTTTGTTTCAGGAGG + Intergenic
955461451 3:59188287-59188309 GATAATTGTTTTGTTTGAGGGGG + Intergenic
955477373 3:59352101-59352123 GATAATTGTTTTGTTTGAGGAGG + Intergenic
956377207 3:68627319-68627341 GATAATTGTTTTGTTTAAGGAGG + Intergenic
956950431 3:74275498-74275520 GATAATTGTTTTGTTTGAGGAGG - Intronic
956995490 3:74822940-74822962 GATAATTGTTTTGTTTGAGGAGG + Intergenic
957202564 3:77155584-77155606 GATAAATGTGTTGTTTAAGCTGG + Intronic
957331471 3:78769868-78769890 AATAATTGTTTTGTTTGAGGAGG + Intronic
957713143 3:83890099-83890121 GATAAGTGTTTTTATTAAAGAGG + Intergenic
957971863 3:87392103-87392125 GGTAATTTTTTTGTTTGAGGAGG - Intergenic
958003132 3:87776933-87776955 GATAATTGTTTTGTTTGAGGAGG + Intergenic
958013986 3:87916056-87916078 GATAATTGTTTTGTTTGAGGAGG - Intergenic
958088132 3:88839508-88839530 GATAATTTTTTTGTCTGAGGAGG + Intergenic
958262771 3:91402473-91402495 GATGTTTGTTTTGTTTGAGGAGG + Intergenic
958480620 3:94642063-94642085 GATAATTGTTTTGTTTGAGGAGG + Intergenic
958490342 3:94764946-94764968 AATAATGGTTTTGTTTGAGGAGG + Intergenic
958505777 3:94974984-94975006 GATAATTGTTTTGGTTGAGGAGG - Intergenic
958770828 3:98423310-98423332 GATAATTGTTTTGTTTGAGGAGG - Intergenic
958787199 3:98611312-98611334 GATAATTGTTTTGTTTAAGGAGG + Intergenic
958969767 3:100599292-100599314 GATAATTGTTTTGTTTGTGGAGG + Intergenic
959039714 3:101406919-101406941 GATAATTGTTTTGTTTGAGGAGG - Intronic
959209405 3:103357822-103357844 AATAACTGTTTTGTGTAATCAGG + Intergenic
959279935 3:104324820-104324842 GACAATTGTTATGTTTGAGGAGG - Intergenic
959436344 3:106319020-106319042 GATAATTGTTTTGTTTATGGAGG - Intergenic
959666412 3:108927021-108927043 GATAATTGCTTTGTTTAAGGAGG + Intronic
959715566 3:109429757-109429779 GATAATTGTTTTGTTTGAGGAGG + Intergenic
959722136 3:109504163-109504185 GATAATTGCTTTGTTTGAGGAGG + Intergenic
959727259 3:109558478-109558500 GACAATTATTTTGTTTAAGGAGG + Intergenic
959756806 3:109909465-109909487 GATAGTTTTTTTGTTTGAGGAGG + Intergenic
959757307 3:109914285-109914307 GATAATTGTTTTGTTTAGGAAGG + Intergenic
959802366 3:110510992-110511014 GATAATTGTTTTGTTTGAGGAGG + Intergenic
959875319 3:111375032-111375054 GATAATTGTTTTGTTTGAGGAGG - Intronic
959877972 3:111408365-111408387 AATAATTGTTTTATTTAAGAAGG - Intronic
960516704 3:118609667-118609689 GATAATTGCTTTGTTTAAGGAGG - Intergenic
960557417 3:119044753-119044775 GATAATTATTTTGTTTAAGAAGG - Intronic
960578282 3:119248484-119248506 GACAATTATTTTCTTTAAGGAGG - Intergenic
960712168 3:120542587-120542609 GACAATTATTTTGTTTAAGGAGG + Intergenic
960761863 3:121080613-121080635 GACAATTATTTTGTTTAAGGAGG + Intronic
960782305 3:121332927-121332949 GATAGTTATTCTGTTTAAGGAGG - Intronic
961967789 3:130924365-130924387 GATAATTGTTTTGTTGAAGGAGG + Intronic
961977926 3:131046398-131046420 GATAATTATTTTCTTTTAGGAGG + Intronic
962013076 3:131412230-131412252 GATAATTATTTTGTTTAAAGAGG - Intergenic
962026957 3:131557771-131557793 CATGCTTGTTTTGTTTAAGGAGG - Intronic
962034603 3:131637885-131637907 GATAATTTTTTTCTTTAAGGAGG - Intronic
962065843 3:131979987-131980009 GATAATTGTTTTGTTTGAGGAGG + Intronic
962147262 3:132853835-132853857 GATAATTGTTTTGTTTAAGGAGG + Intergenic
962401677 3:135065990-135066012 GATAATTGTTTTGCTTGAGGAGG + Intronic
962504783 3:136035517-136035539 GATAATTGTTTTGTTTGAGGAGG + Intronic
962654585 3:137530444-137530466 GATAACTTCCTTTTTTAAGGGGG - Intergenic
962673574 3:137734706-137734728 GATAATTGTTTCATTTAAGGAGG + Intergenic
962764765 3:138551217-138551239 GATAATTGTTTTGTTTAAGGAGG - Intronic
962862011 3:139413010-139413032 GACAATTATTTTGTTTCAGGAGG + Intergenic
962983838 3:140516636-140516658 CATAATTATTTTGTTTAAGAAGG + Intronic
963522356 3:146371609-146371631 GAAAAGTGTTTTGTTTAAGGGGG + Intergenic
963832630 3:150024389-150024411 GATAATTGTTTTGTTTAAGGAGG - Intronic
964017648 3:151966438-151966460 GAAAATTGTTTTGTTTAAGGAGG - Intergenic
964075828 3:152690130-152690152 GATAATTGTTTTGTTTAAGGAGG - Intergenic
964160813 3:153642443-153642465 GATAATTGTTTTGTTTGAGGAGG - Intergenic
964226619 3:154410080-154410102 GATGATTGTTTTGTTTAAGGAGG - Intronic
964269329 3:154938855-154938877 TATAACTATTTTATTTAAAGAGG - Intergenic
964299519 3:155272456-155272478 GATAATTGTTTTGTTTAAGGTGG - Intergenic
964331765 3:155610563-155610585 GATAATTATCTTGTTTGAGGAGG - Intronic
964342705 3:155725068-155725090 GATAATTGTTTTGTTTAAGGAGG + Intronic
964393473 3:156221456-156221478 GATAATTATTTTGATGAAGGGGG - Intronic
964529799 3:157655228-157655250 AATAATTGTGTTGGTTAAGGAGG - Intronic
964601074 3:158502155-158502177 AATAATTGTTTTGTTTGAGAAGG + Intronic
964644001 3:158938322-158938344 GCTAATTGTTTTGTTTAAGGAGG - Intergenic
964867595 3:161278146-161278168 GATAATTGTTTTGTTTAAGGAGG - Intergenic
965052557 3:163669978-163670000 GATAATTGTTTGGTTTGAGAAGG + Intergenic
965060896 3:163784863-163784885 GATATTTGTTTTGTTTAAGAAGG + Intergenic
965154191 3:165025687-165025709 GATAATTGTTTTGTTTAAGGAGG - Intronic
965184726 3:165447969-165447991 GATAATTGTTTTGTTTAAGGAGG - Intergenic
965185099 3:165452872-165452894 GACAATTATTTTGTTTCAGGAGG - Intergenic
965216708 3:165873515-165873537 GAAGATTGTTTTGTTTGAGGTGG + Intergenic
965296455 3:166953802-166953824 GATAATTGTTTTGTTTAAGGGGG + Intergenic
965321711 3:167260124-167260146 GGTAATTGTTTTGTTTGAGAAGG + Intronic
965492479 3:169356053-169356075 GAAAGCTTTTTTGTTTAAAGTGG + Intronic
965745586 3:171921638-171921660 GATAATTATTTTGTTTAAGGAGG - Intronic
965874216 3:173298073-173298095 GATAATTGTTTTGTTTGAGGAGG + Intergenic
966117518 3:176483807-176483829 GATAATTGTTTTGTTTGAGGAGG + Intergenic
966122578 3:176538427-176538449 GATAATTGTTTTATTTAAGAAGG - Intergenic
966123029 3:176544772-176544794 GATATATATTTTGTTTAATGTGG - Intergenic
966229760 3:177639361-177639383 GAAAATTATTTTGTTTAAGCGGG + Intergenic
966352800 3:179048511-179048533 GATAATTGTTTTGTTTAAGAAGG - Intronic
967209249 3:187151970-187151992 GATAATTATTATGTTTGAGGAGG - Intronic
967257347 3:187607625-187607647 GATAATGGTTTTGTCTGAGGAGG + Intergenic
967504750 3:190240823-190240845 AATAATTATTTTGTTTAAGGAGG - Intergenic
967559119 3:190897156-190897178 GATAATTGTTTTGCATCAGGAGG - Intergenic
967651518 3:191991695-191991717 GATAATTATTTTGTTTGAGGAGG - Intergenic
967741406 3:193007033-193007055 GATAATTGTTTTGTTTGAGGAGG + Intergenic
967958533 3:194899470-194899492 GACAATTATTTTGTTTAAGGAGG + Intergenic
968125485 3:196156706-196156728 GATAATTGTTTTGTTTGAGGAGG + Intergenic
968362934 3:198160907-198160929 GAACACTGTGTTGTGTAAGGCGG + Intergenic
968720762 4:2201888-2201910 TACAATTGTTTTGTTTAAGGAGG - Intronic
968807301 4:2783262-2783284 GATAATTCTTTTGTTTAAAGAGG + Intergenic
969165489 4:5306929-5306951 GAAAACTGTTTTGTTTAAGGAGG + Intronic
969947148 4:10795618-10795640 GATGATTGTTTTGCTTGAGGAGG + Intergenic
970215660 4:13757445-13757467 GATAATAGTTTTGTTTAAAGAGG + Intergenic
970283121 4:14479975-14479997 GATAATTGTTTTGTTTAAGGAGG - Intergenic
970658459 4:18258841-18258863 GATTATTGTTTTGTTTGAGGAGG + Intergenic
970726462 4:19051278-19051300 GAAAACTTTTATGTTTATGGTGG + Intergenic
970996261 4:22270324-22270346 GATAATTGTTTTGTTTGAGGAGG - Intergenic
971050248 4:22854097-22854119 GATAATTGTATTGTTTAAGGAGG + Intergenic
971182945 4:24348098-24348120 GATAATTGCTTTGTTTGAGGAGG + Intergenic
971554800 4:28000742-28000764 GATAATTGTTTTGTTTAAGGAGG + Intergenic
971576605 4:28282299-28282321 GATAATTATTTCGTTTAAGTAGG - Intergenic
971652341 4:29294403-29294425 GATACTTGTTTTGTTTCAAGAGG - Intergenic
971720759 4:30243087-30243109 GACAATTATTTTGTTTAAGGAGG + Intergenic
971751688 4:30657643-30657665 GGTAATTATTTTGTTTAAGGAGG + Intergenic
971885576 4:32442923-32442945 GATAATTTTTATGTTTGAGGAGG + Intergenic
971900888 4:32657094-32657116 GATAATTATTTTGTTTGAGGAGG + Intergenic
971938358 4:33183491-33183513 GATAATTGTTTTGCTTAAGGAGG + Intergenic
972048978 4:34703983-34704005 GATAATTGTTTTGTTTGAGGAGG - Intergenic
972188897 4:36567226-36567248 GATAATTGTTTTGTTTGAGGAGG + Intergenic
972302276 4:37796056-37796078 GATAATTATTTAGTTCAAGGGGG + Intergenic
972899614 4:43667503-43667525 GATAATTATTTTGTTTAAGAAGG + Intergenic
973068993 4:45834301-45834323 AATAATTGTTTTGTTTAAGGAGG + Intergenic
973179407 4:47250243-47250265 GATAATTGTTTTGTTTGAGGAGG + Intronic
973244354 4:47994970-47994992 GATAATTGTTTTGTTTGAGGAGG + Intronic
973342898 4:49024642-49024664 GATAATTTTTTGGTTTAAGGAGG + Intronic
973675885 4:53262543-53262565 GATAATTGTTCTGTTTATGGAGG + Intronic
973787246 4:54343553-54343575 GATAATTGTTTTGTTTGAGGAGG - Intergenic
973831343 4:54763125-54763147 GATAATTGTTTGATTTGAGGAGG + Intergenic
973920310 4:55677293-55677315 GATAATTGTTTTATTTAAGGAGG - Intergenic
974457862 4:62151314-62151336 GATAATTGTCGTGTTTGAGGAGG - Intergenic
974472241 4:62333119-62333141 GATAATTATTTTGTTTGAGGAGG - Intergenic
974534055 4:63152092-63152114 GACAACTATTTTGTTTAAGGAGG + Intergenic
974801646 4:66826726-66826748 GATAATTGTTCTGTTTAAGGAGG + Intergenic
974848963 4:67382533-67382555 GACAATTATTTTGTTTAAGGAGG - Intergenic
974857547 4:67478399-67478421 GATAATTGTTTTATTTAAGGAGG - Intronic
974929175 4:68342056-68342078 CATACCTGTTTTGTTGAAGAAGG - Intronic
975243645 4:72093122-72093144 GAAAATTGTTTTGTTTAAGGGGG + Intronic
976014248 4:80531635-80531657 GATTTCTGATTTGTTCAAGGTGG + Intronic
976464986 4:85357026-85357048 GATAATTATTTTGTTTAAGGAGG + Intergenic
976556363 4:86454980-86455002 GATAATTGTTTTGTTTGAGGAGG - Intronic
976562618 4:86519907-86519929 AATAATTATTTTGTTTAAGGAGG + Intronic
976686161 4:87818054-87818076 CATAATTGTTTTGTTTGAGGAGG + Intergenic
976888013 4:90009231-90009253 GATAATTGTTTTGTCTAAGGAGG - Intergenic
976907745 4:90261390-90261412 GACAATTGTTCTGTTTAAGGAGG + Intronic
976918308 4:90405710-90405732 GATAATTGTTTTGTTTAAGAAGG - Intronic
976962939 4:91002045-91002067 GATAATTGTTCTGTTTAAAGAGG + Intronic
977156501 4:93580548-93580570 GATAACTGTTTTGTTGCACCAGG + Intronic
977432843 4:96953803-96953825 AATATTTGTTTAGTTTAAGGCGG + Intergenic
977455252 4:97251297-97251319 GATAACTATTTTAATTAAGGAGG + Intronic
977474096 4:97482907-97482929 AATAATTGTTTTGTTTGAGGAGG - Intronic
977489404 4:97692896-97692918 GATAATTGTTTTGTTTAAGGAGG - Intronic
977510626 4:97957768-97957790 TATAGTTGTTTTGTTTAAGGAGG - Intronic
977746949 4:100560091-100560113 GATAATTGTTTTGTTTGAGGAGG - Intronic
977813718 4:101389027-101389049 TGTAATTGTTTTGTTTAAGGAGG + Intergenic
977826235 4:101534937-101534959 TGAAATTGTTTTGTTTAAGGCGG - Intronic
977905862 4:102477123-102477145 AATAACTGTTTTGTCCAAGGAGG - Intergenic
978027754 4:103898361-103898383 GACTGCTCTTTTGTTTAAGGAGG - Intergenic
978158349 4:105515633-105515655 GATAATTGTTTTGTTTAAGGCGG + Intergenic
978201817 4:106031432-106031454 GATAATCGTTTCATTTAAGGAGG + Intergenic
978316776 4:107446954-107446976 GATAATTGTTTTGTTTGAGGAGG + Intergenic
978646145 4:110933971-110933993 GATATATCTTTTGTTTAAGTTGG + Intergenic
978726513 4:111976236-111976258 GACAATTGTTTTGTTCAAGGAGG + Intergenic
978761998 4:112362935-112362957 GACAACTGTTTTGTTTAAGGAGG - Intronic
978925084 4:114233010-114233032 GATAATTGTTTTGTTTAAGGAGG - Intergenic
978999261 4:115198029-115198051 GATAATTGTTTTGTTTGAGGAGG + Intergenic
979030011 4:115632090-115632112 GATAATTGTTTTGTTTAAGGAGG + Intergenic
979061576 4:116068228-116068250 GATAATTGTTTTGTTTAAGGAGG - Intergenic
979159855 4:117446612-117446634 GCTAATTGTTTTGCTTAAGAAGG + Intergenic
979357155 4:119717570-119717592 GATAATTGTTTTGTTTAAGGAGG - Intergenic
979381927 4:120017006-120017028 GATAATTGTTTTGTTTGAAGAGG + Intergenic
979434908 4:120676162-120676184 GACAATTATTTTGTTTAAAGAGG - Intergenic
979498274 4:121409962-121409984 GATAATTGTTGTGTTTGAAGAGG + Intergenic
979561828 4:122109637-122109659 GATAATTGTTTTGTTTGAGGAGG - Intergenic
979705055 4:123710906-123710928 GATAATTGTTTTGTTTGAGGGGG - Intergenic
979794771 4:124833543-124833565 GATTATTGTTTTGTTTGAGGAGG + Intergenic
980033577 4:127857999-127858021 GCTAATTGTTTTGTATAAGGAGG - Intergenic
980087043 4:128402401-128402423 GATAATTGTTTTGTTTGAGGAGG + Intergenic
980087623 4:128408153-128408175 GATAATTGTTTGGTTTAATGAGG + Intergenic
980186900 4:129473895-129473917 GACAATTATTTTGTTTCAGGAGG + Intergenic
980238014 4:130133325-130133347 GATAATTGTTTTGTTTGAGGAGG - Intergenic
980391935 4:132158177-132158199 GATAATTGTTTTGTTTAAGGGGG + Intergenic
980409801 4:132402513-132402535 GATAATTGTTTAGTTTAAGGAGG + Intergenic
980523779 4:133962702-133962724 GATAATTGTTTTGTTTGAGGAGG - Intergenic
980536368 4:134128503-134128525 GATAATTGTTTTGTTTAAAGAGG - Intergenic
980725537 4:136755188-136755210 GCTAACTGTGTAATTTAAGGTGG - Intergenic
980761251 4:137237317-137237339 GATAATTGTTTTGTTTAAGGAGG + Intergenic
980838337 4:138225678-138225700 GATTATTGTTTTAATTAAGGAGG + Intronic
980860908 4:138498647-138498669 TGAAATTGTTTTGTTTAAGGAGG + Intergenic
981177583 4:141700413-141700435 GACAACTTTTTTGTTTAAGAAGG + Intronic
981346815 4:143685347-143685369 GATAATTACTTTGTTTGAGGAGG - Intronic
981367082 4:143915806-143915828 GATAATTATTTTGTTTAATGAGG - Intergenic
981376878 4:144026044-144026066 GATAATTATTTTGTTTAAAGAGG - Intergenic
981387379 4:144147394-144147416 GATAATTATTTTGTTTAAGGAGG - Intergenic
981626156 4:146757666-146757688 GGTAATTGTTTTGTTTAAGGAGG - Intronic
981760616 4:148191274-148191296 GATAACTGTTTTGTTTGAGGAGG + Intronic
981825012 4:148929960-148929982 GATAATTGTTTTGTTTGAGGAGG - Intergenic
982119442 4:152127649-152127671 GATCGTTGTTTTGTTTGAGGAGG + Intergenic
982189690 4:152841680-152841702 GATAATTGTTTTGCTTGAGGAGG + Intronic
982218605 4:153105704-153105726 GATAACTGTTTTGTTTGACGAGG + Intergenic
982299353 4:153863598-153863620 GATAATCGTTTTGTTTAAGGAGG + Intergenic
982451215 4:155553958-155553980 GATAATTGTTTCATTTAAAGAGG - Intergenic
982491919 4:156040057-156040079 GATAATTGTTTCGTTTGAGGAGG - Intergenic
982630762 4:157826088-157826110 GGTAATTGTTTTGTTTTAGGAGG - Intergenic
982679980 4:158417693-158417715 GATAATTGTTTTGTTTGAGGAGG + Intronic
982800146 4:159696191-159696213 GATAAATATTTTGTTTAAGGAGG + Intergenic
982829915 4:160046029-160046051 GATACTTGTTTTGTTTAAGGAGG - Intergenic
983036011 4:162866505-162866527 GATAATTGTTTTGTTTAAGGAGG - Intergenic
983175531 4:164584300-164584322 GATAATTGCTTTGTTTGAGGAGG + Intergenic
983277611 4:165637095-165637117 GATAATTGTTTGGTTTAAGGAGG - Intergenic
983729692 4:170977979-170978001 GATAACTGTTTTGTTTAAAGAGG + Intergenic
983829158 4:172302803-172302825 GGTAACTTTTTTTTTTAAGAAGG + Intronic
983845428 4:172512734-172512756 AACAATTGTTTTGTTTAAGGAGG + Intronic
983962913 4:173776606-173776628 GATAATTGTTTTGTTTAAGGAGG + Intergenic
984066683 4:175056504-175056526 AATAATTGTTTTGTTTAAGGAGG - Intergenic
984234454 4:177138749-177138771 AATAATTGTTTTGTTTAAGGAGG - Intergenic
984266485 4:177503740-177503762 GATAATTGTTTTGTTTGAGGAGG + Intergenic
984323741 4:178225775-178225797 GATATTTGTTTTGTTTGAGGAGG - Intergenic
984328767 4:178288622-178288644 ACTCACTGTTTTGATTAAGGAGG + Intergenic
984474971 4:180224528-180224550 GATAATTGTTTTGTTTGAGGAGG + Intergenic
984527384 4:180874080-180874102 GGTAATTGTTTTATTTGAGGAGG + Intergenic
984685496 4:182663266-182663288 TATAGCTATTTTGTTGAAGGGGG - Intronic
984721852 4:182979764-182979786 GATAATTGTTTTGTTTGAGGAGG - Intergenic
984923238 4:184784182-184784204 TATTTCTGTTTTGTTTAAGTGGG + Intronic
985008435 4:185558531-185558553 GATAATTGTCTTGTTTGAGGAGG + Intergenic
985108106 4:186519075-186519097 GATAATTGTTTTGTTTAAGGAGG + Intronic
985288734 4:188364094-188364116 AATAATTGTTTTGTTTAAGGAGG - Intergenic
985326280 4:188774730-188774752 GATAATTGTTTTGTTTAAGGAGG + Intergenic
985355917 4:189118479-189118501 GGTAATTGTTTTGTTTATGGAGG - Intergenic
985416884 4:189744085-189744107 TGTTATTGTTTTGTTTAAGGAGG - Intergenic
985812647 5:2101399-2101421 GATAAGTGTTTTGTGAATGGTGG + Intergenic
986259172 5:6127659-6127681 GATTATTGTTTTGTTTATTGAGG - Intergenic
986617713 5:9637219-9637241 GACAATTATTTTGTTTCAGGAGG + Intronic
986634198 5:9803591-9803613 GATATTTGCTTTGTTTGAGGAGG - Intergenic
986870396 5:12038166-12038188 GATAATCATTTTGTTTGAGGAGG - Intergenic
987030240 5:13970579-13970601 GATAATTGTTTTGTTTAAGGAGG + Intergenic
987436743 5:17904504-17904526 AATAATTGTTTTGTTTAAGGAGG + Intergenic
987563720 5:19556985-19557007 GAGAAGTGTTTTGTTCAAGCAGG - Intronic
987640273 5:20603227-20603249 GATAATTGTTTTGTTTAAGGAGG - Intergenic
987898076 5:23974679-23974701 GATACGTGTTTTGTCTAGGGTGG + Intronic
988278287 5:29112125-29112147 GATGATTATTTTGTTTAAGGAGG + Intergenic
988344770 5:30022473-30022495 GATAATTGTTTTGTTTGAGGAGG - Intergenic
988703802 5:33703228-33703250 TATAACTGTTTTGTTCAAATAGG + Intronic
988725018 5:33918220-33918242 GATAATCGTTTTGTTTAAGGAGG + Intergenic
988876063 5:35447083-35447105 GGTAATTGTTTTGTTTAAGGAGG - Intergenic
988889668 5:35600928-35600950 GATAACTGTTTTGTTTAAGGAGG - Intergenic
988902401 5:35747020-35747042 GATAATTGTTTCGTTTGAGGAGG - Intronic
988929699 5:36025250-36025272 GAAAATTGTTTTGTTTCAGGAGG - Intergenic
989027464 5:37084128-37084150 GCTAATTGTTTTGTTTGAGGAGG - Intergenic
989072991 5:37532050-37532072 GAAAATTGTTTTGTTTAAGGAGG + Intronic
989355317 5:40537949-40537971 GATAATTGTTTTGTTTAAGGAGG + Intergenic
989525736 5:42452192-42452214 GACAATTATTTTGTTTAAGGGGG + Intronic
989533642 5:42538467-42538489 AATAATTGTTTTGTTTGAGGAGG + Intronic
989562617 5:42869471-42869493 GATAATTGTTTTGTTTAAGGGGG + Intronic
989689438 5:44123133-44123155 GATAATTGTTTTGTTTAACAAGG + Intergenic
989694247 5:44181246-44181268 GATAATTGTTTTGTTTAAGGAGG + Intergenic
989818267 5:45763069-45763091 GACAATTATTTTGTTTAAGGAGG + Intergenic
990233506 5:53740686-53740708 GATAATTGTTTTGTTTGAGGAGG - Intergenic
990572939 5:57096788-57096810 GATAATTGTTTTGTTTGAGGAGG - Intergenic
990776146 5:59308523-59308545 GATAATTGTTTTGTTTGAGGAGG + Intronic
990891677 5:60657583-60657605 GATAATTATTTTGTTTAAGGAGG + Intronic
990899577 5:60736163-60736185 GATAATTGTTTTGTTTGAGGAGG + Intergenic
991079873 5:62587149-62587171 GATAATGGTTTTGTTGGAGGAGG + Intronic
991387183 5:66102872-66102894 GATAATTATTTTGTTTGAGGAGG - Intergenic
991623145 5:68567016-68567038 GTTACTTGTTTTCTTTAAGGAGG - Intergenic
992184125 5:74227378-74227400 GAGAACTGGTCTCTTTAAGGGGG - Intergenic
992239651 5:74754062-74754084 GATAATTGTTTTGTTTAAGGAGG - Intronic
992335873 5:75769119-75769141 GGTAATTGTTTTTTTTAAGGAGG + Intergenic
992339920 5:75813155-75813177 GATAATTGTTTTGTTTGAGAAGG + Intergenic
992898808 5:81271782-81271804 GATAATTGTTTTGTTTAAGGAGG - Intergenic
993646325 5:90467999-90468021 GATAATTGTTTTGTTTAAGAAGG + Intronic
993743145 5:91564075-91564097 GCTAATTGTTTTGTTTAAGGAGG - Intergenic
993883720 5:93393401-93393423 GATAATTGTTTTGTTTGAGGAGG + Intergenic
993964934 5:94348495-94348517 GAGAATTGTTTTGTTTGAGGAGG - Intronic
994034174 5:95179526-95179548 GATAATTGTTTTGTTTAAGGAGG - Intronic
994165390 5:96602794-96602816 GAAGACCATTTTGTTTAAGGTGG + Intronic
994330037 5:98493666-98493688 GAAAATAGTTTTGTTTGAGGAGG - Intergenic
994347381 5:98702361-98702383 GATAATTGTTTTGTTTAAGAAGG - Intergenic
994363751 5:98886339-98886361 TATGTCTGTTTTGTTTAAAGCGG - Intronic
994398924 5:99255132-99255154 GATAATTGTTTTGTTTAAGAAGG + Intergenic
994496719 5:100521743-100521765 GATAGTTGTTTTGTATAAGGAGG - Intergenic
994603515 5:101938248-101938270 CAAAACTGTTTTGTTTACTGTGG + Intergenic
994778000 5:104060076-104060098 GATAATTGTTTTGTTCAAAAAGG + Intergenic
994860053 5:105180646-105180668 GATAAATGTTTTGTTTCATGTGG - Intergenic
995317738 5:110795933-110795955 GATAATTGTTTTATTTGAGGAGG + Intergenic
995450979 5:112300439-112300461 GATAATTGTTTTGTTTAAGGAGG + Intronic
995472833 5:112521926-112521948 GATAATTGTTTTGTTCGAGAAGG + Intergenic
995699093 5:114913752-114913774 GATAATTATTTTCTTTAAGGAGG - Intergenic
995727536 5:115197292-115197314 GATAATTGTTTTGTTCGAGGAGG - Intergenic
995817984 5:116193011-116193033 GATAATTGTTTTGTGTGAGGAGG - Intronic
995955492 5:117771303-117771325 GATAACTGTTTTGTTTGAGGAGG - Intergenic
996010929 5:118480553-118480575 GATAATTATTTTGTTTGAGGAGG - Intergenic
996032133 5:118717070-118717092 GATAATTGTTTTGTTTGAGGAGG - Intergenic
996110321 5:119557887-119557909 GAAAATTATTTTGTTTAATGAGG - Intronic
996123906 5:119703989-119704011 GATAATTATTTTGTTTGAGGAGG + Intergenic
996141162 5:119911594-119911616 GATAATTATTTTGCTTAATGAGG + Intergenic
996288772 5:121827668-121827690 GATAATTGTTTTGTTTGAGGAGG + Intergenic
996325576 5:122268864-122268886 GATAATTGTTTTGTTTGAGGAGG - Intergenic
996326824 5:122284971-122284993 GATAATTGTTTTGCTTAAGAAGG + Intergenic
996495141 5:124147204-124147226 GATGATTGTTTTGTTTAAGGAGG + Intergenic
996504625 5:124255834-124255856 GATAATTGTTTTGTTTTAGGAGG + Intergenic
996632007 5:125644128-125644150 GACAATTATTTTGTTTGAGGAGG - Intergenic
996678501 5:126203689-126203711 GATAATTGTTTTGTTTAAGGAGG - Intergenic
996694758 5:126381985-126382007 GATAATTGTCTTGTTTAAGGAGG + Intronic
996846404 5:127903823-127903845 GAAAACTGTTTTGTTGGAGGTGG + Intergenic
996875212 5:128233739-128233761 GATAATTCTTTTGTTTAAGGAGG + Intergenic
997058667 5:130475681-130475703 GACAATTATTTTGTTTAAGGAGG + Intergenic
997761097 5:136447922-136447944 GATAATTGTTTTGTTTGAGGAGG - Intergenic
997765406 5:136498659-136498681 GATAACTGTTTGGTTTAAGGAGG + Intergenic
997798175 5:136832680-136832702 AATAATTGTTTTGTTTAAAGAGG + Intergenic
998746231 5:145262537-145262559 GATAGTTGTTTTATTTAAGGAGG - Intergenic
998758761 5:145409068-145409090 GACAATTATTTTCTTTAAGGAGG - Intergenic
998777114 5:145616031-145616053 GATAATTGTTTTGTTTGAGGAGG + Intronic
999086269 5:148893251-148893273 GATAATTATTTTGTTTCAGGAGG - Intergenic
999337681 5:150736458-150736480 GATAATTGTTTTGTTTAAGGAGG - Intronic
999484525 5:151982475-151982497 GATAATTGTTTTGTTTGAGGAGG + Intergenic
999490976 5:152051669-152051691 GATAATCATTTTGTTTAAAGAGG + Intergenic
999677259 5:154016464-154016486 GATAATTGTTTTGTTTGAGGAGG - Intronic
999801103 5:155037662-155037684 GATAATTGTTTTGTTTGAGGAGG + Intergenic
999818794 5:155203456-155203478 GATAATTGTTTTGTTTGAGGAGG - Intergenic
999822868 5:155246423-155246445 GACAATTATTTTGTTTCAGGAGG + Intergenic
999839086 5:155404719-155404741 GATAATTGTTTTGTTTAAGGAGG - Intergenic
1000158895 5:158580453-158580475 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1000264656 5:159623167-159623189 TATAATTGTTTTGTTTAAGGAGG - Intergenic
1000525442 5:162352174-162352196 GGTAATTGTTTTGTTGAAGAGGG + Intergenic
1000757742 5:165182758-165182780 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1000779868 5:165466690-165466712 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1001166846 5:169376227-169376249 GATAATTATTTTGTTTAAGGAGG - Intergenic
1001177000 5:169479611-169479633 GATAATTGTTTTGTTTAAGGGGG + Intergenic
1001290876 5:170458547-170458569 GATAATTGTTTTGTTTAAGGAGG - Intronic
1001370798 5:171198807-171198829 GTTAAGTGTCTTGCTTAAGGTGG - Intronic
1001693600 5:173652622-173652644 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1001693606 5:173652678-173652700 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1001733595 5:173980088-173980110 GATATTTGTTTCGTTTAAGGAGG + Intronic
1002893032 6:1353463-1353485 GACAATTATTTTGTTTCAGGAGG - Intergenic
1003029256 6:2587884-2587906 GATAAATGTTTTGTTTGAGGAGG + Intergenic
1003063322 6:2879108-2879130 GATCATTGTTTTGTTTGAGGAGG - Intergenic
1003297308 6:4843093-4843115 TATAATTGTTTTGTTTAAGGAGG + Intronic
1003451058 6:6231776-6231798 GATAATTGTTTTGTTTGAAGAGG - Intronic
1003465119 6:6371953-6371975 GATAATTCTTTTATTTAAGGAGG - Intergenic
1003582131 6:7349259-7349281 GATAATTGTTTTGGTTGAGGAGG - Intronic
1003930245 6:10917937-10917959 GATAATTGTTTTGTTTGAGGAGG + Intronic
1004096708 6:12562072-12562094 GATAATTATTTTGTTTGAAGAGG - Intergenic
1004600318 6:17143718-17143740 GATAAATATTTGGTTTAAGGAGG + Intergenic
1004888702 6:20076290-20076312 GATAATTGCTTTGTTTAAGGAGG - Intergenic
1005072669 6:21876023-21876045 GGTCATTGTTTTGTTTGAGGAGG - Intergenic
1005259304 6:24041155-24041177 GATAATTACTTTGTTTCAGGAGG + Intergenic
1005305573 6:24511114-24511136 GATAATTGCTTTGTTTGAGGAGG + Intronic
1005413150 6:25572379-25572401 GAAAAGTGTATTGTTGAAGGAGG + Intronic
1005691364 6:28310027-28310049 GATAATTCTTTTGTTTAAGTAGG + Intergenic
1005760483 6:28962922-28962944 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1007122909 6:39398269-39398291 GATAACTGTTTCCTATAATGTGG + Intronic
1007892837 6:45311663-45311685 GAAGATTGTTTTGTTTGAGGAGG - Intronic
1008042126 6:46813842-46813864 AATAATTGTTTTGTTTAAGGAGG + Intronic
1008171856 6:48217500-48217522 GATAATTGTTTTGTTTAAGGAGG - Intergenic
1008256303 6:49304173-49304195 GATAATTGCTTTGTTTGAGGAGG - Intergenic
1008305486 6:49893740-49893762 GATAATTATTTTGTTTGAGGAGG - Intergenic
1008402167 6:51076844-51076866 CATAATTATTTTGTTTAATGAGG + Intergenic
1008487634 6:52052988-52053010 GGTTACTGTTTTTTTTAATGAGG - Intronic
1008528451 6:52432496-52432518 GATAATTCTTTTGTTTAAGGAGG + Intronic
1008775251 6:55030646-55030668 GGCAATTGTTTTGTTTGAGGAGG + Intergenic
1008973407 6:57396958-57396980 GATAATGATTTTGTTTGAGGAGG + Intronic
1008992641 6:57620412-57620434 GATGTTTGTTTTGTTTGAGGAGG - Intronic
1009162312 6:60298502-60298524 GATAATGGTTTTGTTTGAGGAGG + Intergenic
1009181261 6:60519523-60519545 GATGTTTGTTTTGTTTGAGGAGG - Intergenic
1009332341 6:62439784-62439806 GATAGATGTTTTGTTTAAAGAGG + Intergenic
1009360129 6:62801479-62801501 GTTAAGTGTTTGGTTTAAGGAGG + Intergenic
1009389540 6:63129478-63129500 GATAATTGTTTTGCTTGAGGGGG + Intergenic
1009453348 6:63826592-63826614 GATAATTGTTTTGTTTGAGGAGG - Intronic
1009589278 6:65644765-65644787 GATAATTGTTTTGTTTAAGGAGG - Intronic
1009867071 6:69410582-69410604 GATAATTGTTTTGTTTAAGGAGG - Intergenic
1009969011 6:70606349-70606371 GATAATTGTTTTGCTTGAGGAGG - Intergenic
1010017245 6:71119751-71119773 AACAATTATTTTGTTTAAGGAGG + Intergenic
1010045461 6:71437732-71437754 AATAGTTGTTTTGTTTAAGGAGG - Intergenic
1010358420 6:74964072-74964094 GATAATTATTTTGTTTAAGGAGG + Intergenic
1010479707 6:76336657-76336679 GATAATTGCTTTATTTAAGGAGG + Intergenic
1010500672 6:76595364-76595386 GATAATTGCTTTGTTAAAAGAGG - Intergenic
1010518299 6:76801824-76801846 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1010633524 6:78229641-78229663 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1010707601 6:79133714-79133736 GATAATTGTTTCATTTGAGGAGG + Intergenic
1010801716 6:80184727-80184749 GATAATTATTTTATTTAAGGAGG + Intronic
1010817397 6:80374942-80374964 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1010862884 6:80936051-80936073 GATAATTGTTTTGTTTAAGTAGG + Intergenic
1011005413 6:82638959-82638981 GACAATTATTTTGTTTAAGGAGG - Intergenic
1011093342 6:83632140-83632162 GATAATTGTTTTATTTGAGGAGG + Intronic
1011132970 6:84071372-84071394 GGTAATTGTTTGGTTTGAGGAGG + Intronic
1011156472 6:84339432-84339454 GATAATCATTTTGTTTAAGGAGG + Intergenic
1011168802 6:84480825-84480847 GATAATTGGTTTGTTTGAGGAGG - Intergenic
1011225352 6:85098733-85098755 GATAATTGCTTTATTTAATGAGG - Intergenic
1011319806 6:86079101-86079123 GATAATTGCTTTGTTTGAGGAGG + Intergenic
1011327331 6:86163411-86163433 GATAATTTTTTTGTTTGAGGAGG - Intergenic
1011328906 6:86182482-86182504 GATAATTGTTTTGTCTGAGGAGG + Intergenic
1011373397 6:86664852-86664874 AATAATGGTTTTGTTTAAGGAGG + Intergenic
1011620251 6:89236023-89236045 GATAATTGTTTCGTTTAAGGAGG + Intergenic
1011753501 6:90476451-90476473 GTTAACTTTTTTTTTTTAGGTGG - Intergenic
1011789554 6:90884081-90884103 GCTAATTGTTTTGTTTGAGAAGG + Intergenic
1011817683 6:91212154-91212176 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1011833885 6:91405901-91405923 GATAATTGCTTTGTTTGAGGAGG - Intergenic
1011893135 6:92192703-92192725 AATAATTGTTTTGTTTAAGGAGG + Intergenic
1011965655 6:93154813-93154835 GATCATTGTTTTGTTTCAGGAGG + Intergenic
1012204547 6:96444063-96444085 GATAGTTGTTTTGTTTAAGGAGG - Intergenic
1012208196 6:96488033-96488055 TATAATTGTTTTGTTTGAGGAGG + Intergenic
1012299073 6:97562305-97562327 GATAATTGCTTTGTTTAAGGAGG + Intergenic
1012581340 6:100873727-100873749 GATAATTGTTTTGTTTAAGGAGG - Intronic
1012717374 6:102693160-102693182 GATAATTGCTTTGGGTAAGGAGG + Intergenic
1012737993 6:102975078-102975100 GATAATTGTTTCATTTGAGGAGG - Intergenic
1012786381 6:103633305-103633327 GATAATTGTTTTGTTTAAAAAGG - Intergenic
1012870011 6:104661062-104661084 GGTAATTATTTTGTTTCAGGAGG - Intergenic
1012922896 6:105237127-105237149 GACAATGGTTTTGTTTGAGGAGG - Intergenic
1012965794 6:105671256-105671278 GATAATTATTTTGTTTAAGGAGG - Intergenic
1013567811 6:111385617-111385639 GATAACTTTTTTTTTTAAATGGG + Intronic
1013720895 6:113027209-113027231 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1013946285 6:115726866-115726888 GATAATTGTTTCATTTAAGGAGG + Intergenic
1014278434 6:119415042-119415064 GATAATTATTTTGTTTCAGAAGG + Intergenic
1014285137 6:119488416-119488438 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1014304674 6:119726100-119726122 GATAATTATTTTGTTTGAGGAGG + Intergenic
1014312982 6:119829028-119829050 AATAATTCCTTTGTTTAAGGAGG + Intergenic
1014321605 6:119936790-119936812 GATAACAGTTTTGAATAAGAAGG - Intergenic
1014336997 6:120148864-120148886 GATAAGTGTTTTGTTTGAGGAGG - Intergenic
1014481885 6:121949583-121949605 AATAATTGTTTTGTTTAAGGAGG + Intergenic
1014531219 6:122562248-122562270 GATAATTGTTTTGTTTGAGGAGG + Intronic
1014566721 6:122957787-122957809 GATAATTGTTTTGTTTAAGGAGG - Intergenic
1014581548 6:123143438-123143460 GATAATTATTTTGTTTAAGGAGG - Intergenic
1014604066 6:123449917-123449939 GATGATTGTTCTGTTTGAGGAGG - Intronic
1014739209 6:125127276-125127298 GATAATTGTTTTGTATGAGGAGG - Intronic
1014749779 6:125243096-125243118 GCCAATTATTTTGTTTAAGGAGG + Intronic
1015185558 6:130411867-130411889 AATTACTGTTTTTTGTAAGGGGG + Intronic
1015222318 6:130818117-130818139 GATAACTGTTTTGTTTGAGGAGG - Intergenic
1015348026 6:132182090-132182112 GATCATTATTTTGTTTAAGAAGG - Intergenic
1015565752 6:134568747-134568769 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1015644043 6:135367152-135367174 GATGATTGTTTTGTTTAAGGCGG + Intronic
1015663139 6:135599038-135599060 GATACTTGTTTTGTTTGAGGAGG + Intergenic
1015849622 6:137558755-137558777 GATAATTATTTTGTTTGAGGAGG + Intergenic
1015877797 6:137841661-137841683 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1016216159 6:141606555-141606577 GATAATTGTTTCACTTAAGGAGG + Intergenic
1016365769 6:143316385-143316407 GATAATTGTTTTGTTTAAGGAGG + Intronic
1016484921 6:144527287-144527309 TGTAATTGTTTTGTTTAAGGAGG + Intronic
1016496895 6:144673935-144673957 GATAGTTATTTTGTTTAGGGAGG + Intronic
1016735397 6:147473055-147473077 GACAATTGTTATGTTTAAGGAGG + Intergenic
1016909965 6:149189081-149189103 GATAATTGTTTCGTTTAAGGAGG + Intergenic
1016947911 6:149551238-149551260 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1017535142 6:155339620-155339642 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1017690759 6:156961788-156961810 GATTAGTGTTTTGTTTACTGAGG + Intronic
1018009573 6:159657120-159657142 GATAACTGTTTTGTTTGAGAAGG - Intergenic
1018114774 6:160572698-160572720 GATAATTGTTTTGTTTGAGGAGG + Intronic
1018168593 6:161125623-161125645 GATAATTGTTTTGTTTAAGAGGG + Intergenic
1018353108 6:162983599-162983621 GATAATTATTTTGTTTGAGGAGG + Intronic
1018596885 6:165490294-165490316 GATAATTGTTTTGTTTAAGGAGG - Intronic
1018665801 6:166136500-166136522 GACAATTGTTTTGTTTGAGGAGG - Intergenic
1018755443 6:166844620-166844642 GATAATTGTTTTCTTTAAGGAGG - Intronic
1019108872 6:169693191-169693213 GACAATCATTTTGTTTAAGGAGG - Intronic
1019123239 6:169822099-169822121 GGTAATTGTTTTGTTTAAGGAGG + Intergenic
1019252748 7:27804-27826 GAACACTGTGTTGTGTAAGGCGG - Intergenic
1020332203 7:7031036-7031058 GATAATTATTTTGTTTGAGGAGG + Intergenic
1020358416 7:7302188-7302210 GATAATTGTTTTGTTTAAAGAGG + Intergenic
1020373917 7:7463520-7463542 GATAATTGTTTTGTTTGAGGAGG - Intronic
1020410810 7:7889557-7889579 GACAACTGGTTTGCTTAAAGGGG - Intronic
1020608729 7:10368595-10368617 AATAATTATTTTGTTTCAGGAGG - Intergenic
1020635071 7:10686395-10686417 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1020833866 7:13125121-13125143 GAAAATTCTTTTGTTTAAGAAGG + Intergenic
1020860964 7:13490931-13490953 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1021473924 7:21039001-21039023 GATAATTGTTTTTTTTGATGAGG + Intergenic
1021481083 7:21117955-21117977 GATAATTGTTTTGTTTGACAAGG + Intergenic
1022295515 7:29047891-29047913 GATAATTGTTTTGTTTGAGGAGG - Intronic
1022564994 7:31390629-31390651 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1023144534 7:37136573-37136595 GATAATTGTTTTGTTGAAGGAGG - Intronic
1023537573 7:41230041-41230063 GATAATTGCTTTGCTTAAGGGGG + Intergenic
1023657467 7:42439516-42439538 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1023669769 7:42563183-42563205 GATAATTATTTTCTTTAAGAAGG - Intergenic
1023701437 7:42894942-42894964 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1023748794 7:43350155-43350177 GATAATTGTTTTGTTTGAGGAGG + Intronic
1024174916 7:46829057-46829079 GATAATTATTTTGTTTCAGAAGG - Intergenic
1024367134 7:48534265-48534287 GATAATTGCTTTGTTTAAGGAGG + Intronic
1024545671 7:50515257-50515279 GACAATTGTTTTGTTTGAGGAGG - Intronic
1024665452 7:51542661-51542683 GATAGTTGTTTTGTTTAAGGAGG + Intergenic
1024669124 7:51576114-51576136 GATGATTGTTTTGTTTGAGGAGG + Intergenic
1024745192 7:52398583-52398605 GATAATTGTTTTGGTTGAGGAGG + Intergenic
1024840193 7:53576348-53576370 GATAATTGTTTTGTTTAAGGAGG - Intergenic
1024863217 7:53870818-53870840 GACAATTATTCTGTTTAAGGAGG - Intergenic
1024876051 7:54025143-54025165 GACAGTTGTTTTGTTTAAGAAGG + Intergenic
1024946991 7:54818746-54818768 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1025772946 7:64530001-64530023 GATAATTGTTTTGTTTGAGGAGG - Intronic
1025794665 7:64728259-64728281 GATAATTGTTTTGTTCAAGGAGG + Intergenic
1025820773 7:64960847-64960869 AATTATTGTTTTATTTAAGGAGG - Intergenic
1027328862 7:77070299-77070321 GATAATTGTTTTGTTTGAGAAGG + Intergenic
1027350220 7:77304521-77304543 GATACTTGTTTTGCTTGAGGAGG + Intronic
1027417481 7:77988863-77988885 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1027563021 7:79756402-79756424 GATAATTGCTTTGTTTAAGGAGG + Intergenic
1027699392 7:81450748-81450770 TATAATTGTTTTGTTTGAGGAGG - Intergenic
1028028411 7:85876232-85876254 GATAATTGTTTTGTTTAAAAAGG - Intergenic
1028167923 7:87560569-87560591 GTAAACTGTATTGGTTAAGGGGG - Intronic
1028197300 7:87921781-87921803 GACAATTATTTTGTTTAAAGAGG - Intergenic
1028250778 7:88538093-88538115 GATCATTGTTTTGTTTAAGGAGG + Intergenic
1028317364 7:89420144-89420166 TATAACTGTCTTATTTAATGGGG - Intergenic
1028401753 7:90432583-90432605 GACAATTATTTTGTTTAAGGAGG - Intronic
1028502047 7:91529351-91529373 GATAAGTGTTTTGTTTAAGGAGG - Intergenic
1028783042 7:94758778-94758800 GATAATTATTTTGTTTAAGGAGG - Intergenic
1028792759 7:94872259-94872281 GGTAATAGTTTTGTTTAAGGAGG + Intergenic
1028818470 7:95177217-95177239 GATCATTGTTTTGTTTGAGGAGG - Intronic
1028936701 7:96473049-96473071 GATAATTGTTTTGTTTAAAAAGG + Intergenic
1028941503 7:96526857-96526879 AATAACTTTTTTTTTTAAGGAGG - Intronic
1028962061 7:96760444-96760466 GATAATTGTTGTGTTTAAGGAGG + Intergenic
1028993285 7:97073785-97073807 GATAATTATTTTGTTTGAGGAGG + Intergenic
1029053335 7:97712820-97712842 GATAATTGTTTTATTTAAGGAGG - Intergenic
1029786907 7:102801079-102801101 GATAATTGTTTCGTTTGAGAAGG - Intronic
1030325374 7:108213094-108213116 GATAATTGTTTTGTTTGTGGAGG - Intronic
1030390277 7:108919648-108919670 GATAATTATTTTGTTTGAGGAGG + Intergenic
1030456038 7:109774661-109774683 GATAGTTGTTTTGTTTAACGAGG - Intergenic
1030533616 7:110738913-110738935 GATAATTGTTTTGTTTAACGAGG - Intronic
1030584755 7:111403578-111403600 AATATATGTTTTGTTTAAAGGGG + Intronic
1030936167 7:115586725-115586747 GATAATGGTTTTGTTTGAGGAGG - Intergenic
1030972483 7:116077125-116077147 GATAATAGTTTTGCTTAAGGTGG - Intronic
1031090272 7:117346545-117346567 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1031139030 7:117920600-117920622 GATAATTATTTTGTTTAAGGAGG - Intergenic
1031261516 7:119526545-119526567 GATAATTGTTTTGTTTAAGGAGG - Intergenic
1031611839 7:123837196-123837218 TAAAATTGTTTTGTTTAAGAGGG + Intronic
1031650148 7:124278707-124278729 GATAATTTTTTTTTTTGAGGTGG + Intergenic
1031675944 7:124611956-124611978 GACAATTATTTTGTTTCAGGAGG - Intergenic
1031740158 7:125419208-125419230 GCTAATTGTTTTGTTTGAAGAGG - Intergenic
1031761092 7:125714629-125714651 GACAATTGTTTTGTTTTAGGAGG + Intergenic
1031796751 7:126185033-126185055 GATAATTATTTTGCTTGAGGAGG + Intergenic
1031799186 7:126221690-126221712 GATAATCATTTTGTTTAAGGAGG + Intergenic
1031828096 7:126590722-126590744 GATAATTGTTTTGTTTAAGTAGG - Intronic
1032288827 7:130567661-130567683 GATAATTATTTTTTTTAAGGAGG - Intronic
1032292670 7:130602878-130602900 GAGACCTGGCTTGTTTAAGGTGG + Intronic
1032448750 7:132008475-132008497 GATAATTATTTTGTTTAAGGAGG + Intergenic
1032605113 7:133342328-133342350 GATAATTGTTTTGTTTAAGGAGG + Intronic
1032931683 7:136679467-136679489 GATAATTGTTTTGTTTAAGGAGG - Intergenic
1033026991 7:137783826-137783848 GGTAACTGTTTTGCTTAAGGAGG - Intronic
1033400955 7:141024775-141024797 GATAATTGTTTTGTTAAAGGAGG + Intergenic
1033623058 7:143079428-143079450 GATGATTGTTTTGTTTAAGGAGG - Intergenic
1033816513 7:145080940-145080962 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1034058688 7:148066075-148066097 TTTAATTATTTTGTTTAAGGAGG + Intronic
1034683021 7:152945617-152945639 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1034705335 7:153138143-153138165 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1035151386 7:156875664-156875686 GATAATTGTTTTGTTTAAGGAGG - Intronic
1035591284 8:816514-816536 GGTAATTGTTTTGTTTAAGGAGG + Intergenic
1036827522 8:11989245-11989267 GACAGTTGTTCTGTTTAAGGAGG - Intergenic
1037320663 8:17639568-17639590 GATGATTCTTTTGTTTAAGGAGG + Intronic
1038367042 8:26947064-26947086 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1038892955 8:31747518-31747540 GGTACCTGTTTTGTGTAATGTGG + Intronic
1038908921 8:31939260-31939282 AATAATTGTTTTGTTTAAAGAGG - Intronic
1039030271 8:33301039-33301061 AATAACCGTTTTGTTTTAGAAGG - Intergenic
1039083124 8:33753963-33753985 GATAATTATTTTGTTTGAGGAGG + Intergenic
1039095382 8:33879458-33879480 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1039763709 8:40606470-40606492 GATAATTATTTTGTTTAAGGAGG + Intronic
1039811303 8:41050839-41050861 GATAATTGCTTTGTTTAAGAGGG - Intergenic
1040362579 8:46681698-46681720 GACTATTATTTTGTTTAAGGAGG + Intergenic
1040399294 8:47032399-47032421 GATAATTGTTTTGTTTAAAGAGG + Intergenic
1040442660 8:47460950-47460972 GATAATTGTTTTGTTTAAGGAGG + Intronic
1040529191 8:48252408-48252430 GATAATTGTTTTGCTTAAGTAGG + Intergenic
1040635496 8:49269079-49269101 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1040800417 8:51333187-51333209 GAAGATTGTTTTGTTTGAGGAGG - Intronic
1040820310 8:51548536-51548558 AACAATTATTTTGTTTAAGGAGG - Intronic
1040857214 8:51960661-51960683 GAAAACTGATTTGAGTAAGGGGG + Intergenic
1040867843 8:52068866-52068888 GACAATTATTTTGTTTGAGGAGG + Intergenic
1041227944 8:55718554-55718576 GATAATTGTTTTGTTTGAGGAGG - Intronic
1041570371 8:59331705-59331727 AATAATTGTTTTGTTTGAGGAGG + Intergenic
1041832194 8:62166425-62166447 AATAATGGTTTCGTTTAAGGAGG - Intergenic
1041877807 8:62711028-62711050 GATAATTGTTTTGTTTGAGAAGG + Intronic
1041879642 8:62734893-62734915 GATAATTGTTTTGTTTGAAGAGG + Intronic
1041897305 8:62939603-62939625 GATAATCGTTTTGTTTAAGGAGG - Intronic
1041984640 8:63907775-63907797 TAAAAGTGTTTTGTTTAAGCAGG - Intergenic
1042084357 8:65091251-65091273 GACAATTATTTTGTTTAAGGAGG - Intergenic
1042160741 8:65891789-65891811 GACAGTTGTTTTGTTTAAGGAGG - Intergenic
1042431560 8:68712035-68712057 AATAATTGTTTTGTTTAAGGAGG - Intronic
1042466962 8:69139502-69139524 AATAATTGTTTTGTTTGAGGAGG + Intergenic
1042645388 8:70980930-70980952 GATAATTGTTTCATTTAAGGAGG + Intergenic
1042728858 8:71909119-71909141 GATAATTATTTTGTTTAAGGAGG + Intronic
1042768265 8:72351281-72351303 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1042897005 8:73681315-73681337 GATAATTATTTTATTTAAGGAGG - Intronic
1043040942 8:75261030-75261052 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1043071545 8:75642215-75642237 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1043121513 8:76331308-76331330 GATAATTGTTTCGTTTGAGGAGG + Intergenic
1043205767 8:77437348-77437370 GATAATTGTTTTGTTTGAGAAGG + Intergenic
1043270870 8:78331111-78331133 GATAATTGTTTTATTTGAGGAGG - Intergenic
1043545277 8:81307985-81308007 GATAATTGTTTTGTTTAAGGAGG - Intergenic
1043679075 8:82998488-82998510 GATCATTTTTTTGTTTAAGGAGG - Intergenic
1043816711 8:84811306-84811328 GATAATTGTTTTGTTTAAAGAGG + Intronic
1043876206 8:85489824-85489846 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1043985680 8:86693020-86693042 GATTATTGTTTTGTTTAAGGAGG + Intronic
1043988002 8:86716569-86716591 GCTAATTGTTTTGTTTAAGGAGG - Intronic
1044227772 8:89738350-89738372 GATAATTGCTTTGTCTGAGGAGG - Intergenic
1044788085 8:95817687-95817709 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1044903500 8:96973720-96973742 GATAATTGTTTTGTTTAAGGAGG - Intronic
1044947717 8:97406656-97406678 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1045094964 8:98787782-98787804 GATAATTGTTTTGTTTGAGGAGG - Intronic
1045122141 8:99049452-99049474 GATAATTGCTTTGTTTAAGGAGG + Intronic
1045429219 8:102097674-102097696 GATAAGAGTCTTGTATAAGGAGG - Intronic
1045634685 8:104170944-104170966 GACAGTTATTTTGTTTAAGGAGG + Intronic
1045671205 8:104554974-104554996 GATAGTTGTTTTGTTTAAGGAGG - Intronic
1046343085 8:112884461-112884483 GATAATTGTTTTGTTATAGAGGG + Intronic
1046369412 8:113281968-113281990 GATAATTGTTTTGTTTGAGGAGG + Intronic
1046394770 8:113626984-113627006 GAAAATTGTTTTGTTTAAGGAGG - Intergenic
1046541063 8:115584025-115584047 GATAACTTTTTTTTTTAAACTGG - Intronic
1046975554 8:120272144-120272166 GACAGTTATTTTGTTTAAGGAGG - Intronic
1047227158 8:122966445-122966467 GGTAATTATTTTGTTTAAGGAGG + Intronic
1047277176 8:123415194-123415216 GATAATTGTTTTGTTTGAGGAGG + Intronic
1047413281 8:124641713-124641735 GATACTTGATTTGTTTTAGGGGG - Intronic
1047592173 8:126338042-126338064 GACAATTATTTTGTTTCAGGAGG - Intergenic
1047607122 8:126486518-126486540 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1047798136 8:128278829-128278851 GATAATTGTTTTCTTTAAGCAGG - Intergenic
1047890281 8:129301514-129301536 GATGAATGTTTTGTTTAATGAGG + Intergenic
1047901679 8:129430041-129430063 GATAATTGTTTTGCTTAAGGAGG + Intergenic
1047937307 8:129795382-129795404 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1048120267 8:131572925-131572947 AAAAATTGTTTTGTTTAAGGAGG + Intergenic
1048221220 8:132543832-132543854 GATAAATGTTGTGGTTAGGGAGG - Intergenic
1048530882 8:135249402-135249424 GATCATTGTTTTGTTTAAGGAGG + Intergenic
1048722983 8:137348299-137348321 GTTAACTGCTTTCTTTAATGTGG + Intergenic
1049086539 8:140482784-140482806 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1049295814 8:141836683-141836705 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1049869616 8:144964300-144964322 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1049897927 9:127980-128002 GATAATTGTTTTGTTTGAGGAGG + Intronic
1050008525 9:1160417-1160439 GATAGCAATTTTCTTTAAGGAGG - Intergenic
1050133446 9:2437823-2437845 AATAATTGTTTTGTTCAAGGAGG + Intergenic
1050133744 9:2440137-2440159 GACAGCTATTTTGTTTCAGGAGG + Intergenic
1050147558 9:2585025-2585047 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1050301732 9:4265579-4265601 GACAACATTTTTGTTTTAGGAGG - Intronic
1050502865 9:6316672-6316694 GATAACTGTTTTGTTTGGGGAGG - Intergenic
1050903694 9:10976681-10976703 GATAACTGTTTTGTTTAAGGAGG - Intergenic
1050972151 9:11891839-11891861 GATAACTGTTTTGCTTAAGGAGG + Intergenic
1051362853 9:16296266-16296288 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1051733360 9:20171067-20171089 GATAATTGTTTCCTTTAAGGAGG - Intergenic
1051929629 9:22368837-22368859 GATAATTGTTTTGTTTAAGGAGG - Intergenic
1052006495 9:23356241-23356263 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1052218483 9:25994044-25994066 GACAGTTGTTTTGTTTAAGGAGG - Intergenic
1052247048 9:26348417-26348439 GATAATTGTTTCGTTTGAGGAGG - Intergenic
1052253765 9:26429166-26429188 GATAATTATTTTGTTTAAGGAGG - Intergenic
1052550103 9:29937506-29937528 GATACTCGTTTTGTTTGAGGAGG + Intergenic
1052624742 9:30961016-30961038 GATAATTGTTTTGTTTTGGGAGG + Intergenic
1053231582 9:36414846-36414868 GGTAATTGTTTTGTTTAAGGAGG + Intronic
1053399311 9:37803086-37803108 CATAACAGTTTTGTAAAAGGTGG + Intronic
1053741007 9:41138273-41138295 GATAATTGTTTTGTTTGAGGAGG + Intronic
1053753374 9:41278605-41278627 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1054258902 9:62842968-62842990 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1054332881 9:63777072-63777094 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1054443995 9:65294416-65294438 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1054486277 9:65727089-65727111 GATAATTGTTTTGTTTGAGGAGG - Intronic
1054687342 9:68293024-68293046 GATAATTGTTTTGTTTGAGGAGG - Intronic
1054938973 9:70719211-70719233 GATAATTATTTTATTTAAGGAGG - Intronic
1054940664 9:70737204-70737226 GATAATTATTTTATTTAAGGAGG - Intronic
1055125847 9:72717585-72717607 GATAATTGTTTTGTTTAAGGAGG + Intronic
1055138076 9:72845762-72845784 GGTAAATGTTTTATTTAAGGAGG - Intergenic
1055156477 9:73068416-73068438 GATAATTGTTTTGTTTAAGGAGG - Intronic
1055244732 9:74225845-74225867 GACAATTGTTTTGTTTAAGGAGG - Intergenic
1055346821 9:75348654-75348676 GATAATAGTTTTGTTTGAGCAGG + Intergenic
1055846698 9:80573423-80573445 TCTAACTGTTTTGTTTAAGGAGG - Intergenic
1055905630 9:81291070-81291092 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1056025838 9:82494610-82494632 AATAAATGTTTTGTTTAAGGAGG + Intergenic
1056309603 9:85325856-85325878 GATAATTATTTTACTTAAGGAGG - Intergenic
1056312755 9:85358130-85358152 GACAATTATTTTGTTTAAGGAGG + Intergenic
1056322557 9:85450699-85450721 GATAATTGTTTTGCTTGAGGAGG + Intergenic
1056396815 9:86188734-86188756 GGTAATTGTTTTGTTTAAGGAGG - Intergenic
1056696367 9:88857726-88857748 GATAATTGTTCTGTTTAAGGAGG - Intergenic
1057789124 9:98111053-98111075 GATAATTGTTTTTTTTTGGGGGG - Intronic
1058156557 9:101523017-101523039 GTTAAGTGTTTTGTTTGAGGAGG + Intronic
1058233755 9:102463108-102463130 TATAATTGTTTTGTTTAAGGAGG - Intergenic
1058410579 9:104726403-104726425 GATAATTGTTTTATTTGAAGAGG - Intergenic
1058540532 9:106007929-106007951 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1059032852 9:110718933-110718955 GATAATTGCTTTGTTTTAGGAGG - Intronic
1059609421 9:115876919-115876941 GATAATGGTTTTGTTTAAGGAGG + Intergenic
1059673943 9:116518357-116518379 GGTAATTCTTTTGTTTAAGCAGG - Intronic
1060311028 9:122462713-122462735 GATAATTGTTTTGTTTATGGAGG + Intergenic
1060314294 9:122494976-122494998 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1061777795 9:132977617-132977639 GATGACTGATTTATTTCAGGAGG - Intronic
1062705526 9:137938111-137938133 GATAACTGTTTTGTTTAAGGAGG - Intronic
1062747621 9:138224570-138224592 GAACACTGTGTTGTGTAAGGCGG + Intergenic
1202799877 9_KI270719v1_random:165383-165405 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1203636252 Un_KI270750v1:115573-115595 TGTTATTGTTTTGTTTAAGGGGG + Intergenic
1185934295 X:4238287-4238309 TATAACTTTTTTGTTTAGGTGGG - Intergenic
1186947492 X:14585054-14585076 GACAACTGTTTTGGATTAGGTGG + Intronic
1187109123 X:16277914-16277936 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1187219028 X:17306415-17306437 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1187589018 X:20694923-20694945 AATAATTGTTTTGTTTAAGGAGG - Intergenic
1187752031 X:22477478-22477500 GATAATTGTTTTCTTTAAGGAGG + Intergenic
1188040357 X:25364897-25364919 GATAATGGTTTTGTTTGAAGAGG + Intergenic
1188045721 X:25424649-25424671 GATAATTGTTTTGTTTGGGGAGG + Intergenic
1188237295 X:27746495-27746517 AAAAACTATTTTGCTTAAGGAGG + Intronic
1188389193 X:29599311-29599333 GATAATTGTTTTATTTAAGGAGG + Intronic
1188737830 X:33740718-33740740 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1189413778 X:40795926-40795948 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1189567369 X:42256522-42256544 GATAATTGTTTTGTTTAAGGAGG - Intergenic
1189599982 X:42614097-42614119 GATAATTTTTTTTTTTATGGAGG + Intergenic
1189603316 X:42649954-42649976 GATAATTGTTTCATTTGAGGAGG - Intergenic
1189663091 X:43324823-43324845 GCTAATTATTTTCTTTAAGGAGG + Intergenic
1189668454 X:43382287-43382309 GATAATTGTTTTGTTTAAGGAGG - Intergenic
1189844855 X:45126164-45126186 GATAATTGTTTTGTTTACGGAGG - Intergenic
1189878982 X:45469795-45469817 GATAATTGTTTTGTTTGAGTAGG + Intergenic
1189931885 X:46020913-46020935 GATAATTGTTTTGTTTGAAGAGG - Intergenic
1189945838 X:46177875-46177897 GATTATTGTTTTGTTTAAGGAGG + Intergenic
1189962209 X:46334309-46334331 GATCATTGTTTTGTTTGAGGAGG - Intergenic
1190449099 X:50559421-50559443 GGTAATTGTTTTGTTTGAGGAGG - Intergenic
1190632028 X:52397501-52397523 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1190895310 X:54612720-54612742 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1190897159 X:54632062-54632084 GATAATCGTTTTGTTTAAGGAGG + Intergenic
1190955759 X:55191763-55191785 GACAGCTGTTCTGTTTAAGGAGG + Intronic
1191037840 X:56046671-56046693 CCTAATTATTTTGTTTAAGGAGG + Intergenic
1191045488 X:56131338-56131360 GATAATTGTTTTGTTTAAGGAGG - Intergenic
1191077135 X:56467364-56467386 GACAATTATTTTGTTTCAGGAGG + Intergenic
1191114704 X:56840485-56840507 GAAAATTGTTTTCTTTAAGAAGG + Intergenic
1191144676 X:57153655-57153677 TGTAATTGTTTTGTTTAATGAGG + Intergenic
1191151645 X:57226441-57226463 GATAATTGTTTTGTTTGAGAAGG + Intergenic
1191180453 X:57557588-57557610 GATAATTGTTATGTGAAAGGAGG - Intergenic
1191779710 X:64852594-64852616 GAAGATTGTTTTGTTTGAGGAGG + Intergenic
1191790513 X:64967530-64967552 CATAACTGTTATGGTTAAAGTGG + Intronic
1191804983 X:65126278-65126300 GATAATTGTTTTGTTCCAGGAGG + Intergenic
1191806881 X:65145775-65145797 GATAATTGTTTTGCTTGAGGAGG + Intergenic
1191813755 X:65220055-65220077 AATAATTGTTTTGTTTGAGGAGG - Intergenic
1191888724 X:65918851-65918873 GACAACTGCTTTGTTTAAAGAGG + Intergenic
1191903411 X:66062993-66063015 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1191906124 X:66092561-66092583 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1191917392 X:66217382-66217404 GATAATTGTTTAGTTTGAGGAGG - Intronic
1191945128 X:66525361-66525383 GATCATTGTTTTGTTTAAGGAGG + Intergenic
1191965084 X:66749445-66749467 GATAATTGTTTTGTTTATGGAGG + Intergenic
1192021777 X:67401300-67401322 GGCAATTATTTTGTTTAAGGAGG + Intergenic
1192120508 X:68450690-68450712 TATAACTTTTTTTTTTAAGATGG - Intergenic
1192164135 X:68814411-68814433 GATAATTATTTTGTTTAAGGAGG - Intergenic
1192298220 X:69872097-69872119 GATAATTGTTTTGTTTAAGGAGG - Intronic
1192609816 X:72556100-72556122 GATAATTGTTTTGTTTAAGGAGG - Intronic
1192673852 X:73174314-73174336 AATAATTGTTTTCTTTAAGGAGG + Intergenic
1192682877 X:73270182-73270204 GACAATTGTTGTGTTTAAAGAGG - Intergenic
1192688486 X:73333424-73333446 GGTAATTGTTTTGTTTAAGGAGG + Intergenic
1192820390 X:74638478-74638500 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1192878301 X:75255202-75255224 GATAATTTTTTTGTTTGAGGAGG - Intergenic
1192900195 X:75488369-75488391 GACAATTATTTTGTTTAAGGTGG - Intronic
1192913473 X:75630685-75630707 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1192929744 X:75793234-75793256 GATCAGTGTTTTGTTTGAGGAGG - Intergenic
1192944874 X:75955720-75955742 AATAATTGTTTTCTTTAAGGAGG + Intergenic
1192970121 X:76219916-76219938 TATAATTGTTTTGTTAGAGGAGG + Intergenic
1192981907 X:76353243-76353265 GATAATTATTCTGTTTAAGTAGG - Intergenic
1193007797 X:76640843-76640865 GATAATTGTCTTATTTAAGGAGG + Intergenic
1193062904 X:77224856-77224878 GATAGTTGTTTTGTTTCAGGAGG - Intergenic
1193077177 X:77366366-77366388 GATAATTCTTTTGTTTGAGGAGG - Intergenic
1193078121 X:77376685-77376707 GATAATTGTTTTGTCTAAGGAGG - Intergenic
1193154768 X:78160256-78160278 GAAGATTGTTTTGTTTGAGGAGG - Intergenic
1193185698 X:78509368-78509390 GATAATTGTTTTGTTTAAGGAGG - Intergenic
1193197097 X:78644975-78644997 GATTATTGTTTTCTTTAAGGAGG - Intergenic
1193253230 X:79318096-79318118 GATAATTGTTTTGCTTGAGGCGG + Intergenic
1193255529 X:79344034-79344056 GACAATTATTTTGTTTCAGGAGG - Intergenic
1193314895 X:80053658-80053680 GATAACAGTTTTGTTTATGGAGG + Intergenic
1193366475 X:80639566-80639588 GATAATTGCTTTGTTTAAGGAGG - Intergenic
1193389057 X:80905651-80905673 GATAATTGTTTTGTTTTAGGAGG + Intergenic
1193405056 X:81090455-81090477 AATAATTGTTTTGTTCAAGGAGG - Intergenic
1193420982 X:81281518-81281540 GATAATCATTTTGTTTAAGGAGG - Intronic
1193423603 X:81314783-81314805 GATAATTGTTTTGCTTAAGGAGG + Intergenic
1193437935 X:81501871-81501893 CATAATTGTTTTGTTTAAGGAGG + Intergenic
1193541071 X:82773743-82773765 GATAATTGTTTTGTTTAAAGAGG + Intergenic
1193578692 X:83234222-83234244 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1193625986 X:83820228-83820250 GACAATTATTTTCTTTAAGGAGG + Intergenic
1193632017 X:83900929-83900951 GATAATTGTTTTGTACAATGAGG - Intergenic
1193690575 X:84636343-84636365 GATAATTGTTTTGTTTAAGGAGG - Intergenic
1193723439 X:85014611-85014633 GACAATTATTTTATTTAAGGAGG + Intronic
1193736596 X:85164529-85164551 GATAATTATTTTATTTAAGGAGG + Intergenic
1193771738 X:85595293-85595315 GATAATTGTTTAGTTTAAGGAGG - Intergenic
1193775792 X:85640539-85640561 GATAATTGTTTTGCTTAAGGAGG + Intergenic
1193785851 X:85759212-85759234 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1193817394 X:86120722-86120744 GATAATTGTTTAGTTTAAGGAGG + Intergenic
1193924605 X:87467960-87467982 GGCAATTATTTTGTTTAAGGAGG - Intergenic
1193937314 X:87638543-87638565 ACTAATTGTTTTGTTTAAGGAGG - Intronic
1193950871 X:87796469-87796491 CATAATTGTTTTGTTTAAGGAGG - Intergenic
1194058562 X:89167172-89167194 AATAATGGTTTTGATTAAGGAGG - Intergenic
1194089940 X:89573304-89573326 GACAGTTGTTCTGTTTAAGGAGG + Intergenic
1194095173 X:89630896-89630918 TATAATTGTTTTGTTTAAGGAGG + Intergenic
1194165510 X:90509511-90509533 GATAATTGTTTTGTTTAAGGGGG - Intergenic
1194183964 X:90748690-90748712 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1194191831 X:90847040-90847062 AATAATTATTTTGTTTTAGGAGG + Intergenic
1194214279 X:91109401-91109423 GATAATTATTTTGTTTAAGGTGG + Intergenic
1194224753 X:91243161-91243183 GATAATTATTTTGTTTAAGATGG + Intergenic
1194381263 X:93193983-93194005 GATAATTGTTTTGTTTCAGAAGG - Intergenic
1194384890 X:93239682-93239704 GACAATTATTCTGTTTAAGGAGG - Intergenic
1194470096 X:94283915-94283937 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1194471274 X:94301024-94301046 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1194510274 X:94784842-94784864 GATAGTTGTTTTGTTTAGGAAGG - Intergenic
1194516109 X:94855935-94855957 GATTATTGTTTTGCTTAAGATGG - Intergenic
1194543295 X:95202101-95202123 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1194553946 X:95334441-95334463 GATAATTGTTTTGTTTAAGGAGG - Intergenic
1194596533 X:95865854-95865876 GACAGTTGTTCTGTTTAAGGAGG - Intergenic
1194601420 X:95925664-95925686 AATAATTGTTTTGTTTAAGGAGG - Intergenic
1194630436 X:96275985-96276007 GATAATTGTTTTGTTTAAGGAGG - Intergenic
1194881672 X:99260033-99260055 GATAATTGTTTTATTTACGGAGG + Intergenic
1194882413 X:99270617-99270639 GATAATCGTTTTGTTTGGGGAGG + Intergenic
1194926752 X:99835144-99835166 AATAATTGTTTTGTTTGAGGAGG + Intergenic
1194967516 X:100305273-100305295 GATAATTGTTTCATTTAAGGAGG - Intronic
1195015971 X:100781411-100781433 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1195019338 X:100811321-100811343 GATAATTATTTTGTTTGAGGAGG + Intergenic
1195076147 X:101328701-101328723 GATAATTGTTTTGTTCGAGGAGG - Intergenic
1195154195 X:102106116-102106138 GATAATTGTTTTGTTTAAGAAGG - Intergenic
1195231815 X:102858033-102858055 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1195237292 X:102913023-102913045 GATAATTGTTTTGCTTAAGGAGG - Intergenic
1195795627 X:108643564-108643586 GATAATTGTTTTGTTTGAGGAGG - Intronic
1195818206 X:108911392-108911414 GGAAATTATTTTGTTTAAGGAGG - Intergenic
1195855366 X:109326177-109326199 GATAATTGTTTTGTTTAAGGAGG - Intergenic
1195972652 X:110490540-110490562 GATAGTTGTTTTGTTTAAGGAGG + Intergenic
1195985002 X:110620335-110620357 GATAAATGTTCTGTTTAAAGAGG + Intergenic
1196024171 X:111022377-111022399 GATAATTGTTTTGTTGAAGGAGG - Intronic
1196161488 X:112488832-112488854 GATAATTATTTTGTTTGAGGAGG - Intergenic
1196225006 X:113156516-113156538 GATAATTGTTTTGTTTTAGGAGG + Intergenic
1196477903 X:116110609-116110631 GATAATTGCTTTGTTTAAGGAGG + Intergenic
1196484732 X:116192610-116192632 AATAATTATTTTGTATAAGGAGG + Intergenic
1196519223 X:116653553-116653575 GCTAATTGTTTTGTTTAAGGAGG + Intergenic
1196530787 X:116783922-116783944 GATAATTGTTTTGCTTGAGGAGG - Intergenic
1196590328 X:117480142-117480164 GATAATTGTTTTATTTGAGGAGG + Intergenic
1196675581 X:118417474-118417496 GATAATTGTTTTGTTTGAGGAGG + Intronic
1196737683 X:118993874-118993896 GGTAATTGTTTTGCTTGAGGAGG - Intronic
1196917253 X:120549987-120550009 GAGAACTGTTTTATTTGAGAAGG - Intronic
1196948105 X:120848884-120848906 GATGATTGTTTCGTTTGAGGAGG + Intergenic
1197055335 X:122112351-122112373 GAAAATTGTTTTCTTTAAGGAGG + Intergenic
1197066067 X:122235903-122235925 GATAATTGTTTTGTTTCAGGAGG + Intergenic
1197079880 X:122399420-122399442 GACAATTATTTTGTTTAAGGAGG - Intergenic
1197102651 X:122674336-122674358 AATAATTGTTTTATTTGAGGAGG - Intergenic
1197120245 X:122882087-122882109 AATAATTGTTTTGTTTAAGGAGG - Intergenic
1197132573 X:123021531-123021553 GATACTTGTTTTGTTTGAGGAGG - Intergenic
1197184552 X:123571848-123571870 GATAATTGTTTTGTTTAAGGAGG - Intergenic
1197363739 X:125537844-125537866 GGTAATTGTTTTGTTTGAGGAGG - Intergenic
1197393140 X:125893895-125893917 GATAGTTGTTTTGTTTAAGGAGG + Intergenic
1197463571 X:126773030-126773052 GATAATTGTTTTGTTTAAGGAGG - Intergenic
1197476148 X:126928231-126928253 GACAATTGTTTTATTTCAGGAGG + Intergenic
1197504078 X:127279751-127279773 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1197515378 X:127421572-127421594 GATCATTGTTTTGTTTAAGGAGG + Intergenic
1197519082 X:127474549-127474571 GATAATTGTTTTGTTTGAGGAGG - Intergenic
1197574232 X:128189424-128189446 GATAATTGTTTTGTTTGAGAAGG - Intergenic
1197575783 X:128209377-128209399 GATAGTTGTTTTGTTTAAGGAGG - Intergenic
1197589077 X:128385603-128385625 GATAATCGTTTTGTTTGAGGAGG - Intergenic
1197604012 X:128563088-128563110 TACAATTATTTTGTTTAAGGAGG - Intergenic
1197668911 X:129254515-129254537 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1197671423 X:129282670-129282692 GATAATTGTTTCGTTTGAGGAGG + Intergenic
1197687503 X:129457006-129457028 GATAAATCTTTTGTGAAAGGAGG + Intronic
1197910819 X:131481016-131481038 AATAATTGTTTTGTTTAAGGAGG - Intergenic
1197953864 X:131925215-131925237 GTTAATTGTTTTGTTTGAGGAGG - Intergenic
1198559757 X:137836801-137836823 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1198583056 X:138088101-138088123 GATAATTGTTTTGTTTGAAGAGG - Intergenic
1198604378 X:138321041-138321063 GATAATTACTTTGTTTAGGGAGG + Intergenic
1198616615 X:138464703-138464725 GATAATTGTTTTGTTTTAGGAGG - Intergenic
1198712638 X:139522402-139522424 GATTATTGTTTTGTTTAAGGAGG - Intergenic
1198797113 X:140409229-140409251 GATAATTGTTTTGTTTAAAGAGG + Intergenic
1198943131 X:141980823-141980845 GATCATTGTTTTGTTTAAGGAGG + Intergenic
1199014801 X:142803018-142803040 GATAATTGTTTGGTTTAAGGAGG + Intergenic
1199057668 X:143317687-143317709 GATAATTGTTTTGTTTGAGGAGG + Intergenic
1199206102 X:145149944-145149966 GATAATTGTTTTGTTTAATGAGG - Intergenic
1199424359 X:147683477-147683499 GACAATTATTTTGTTTCAGGAGG - Intergenic
1199521336 X:148739940-148739962 GATAATTGTTTTGTTTGAGGAGG + Intronic
1199553711 X:149083008-149083030 GATGGTTGTTTTGTTTAAGGAGG - Intergenic
1199668717 X:150122640-150122662 GATAACTGTTTTGCTTGAGGAGG - Intergenic
1199913834 X:152316708-152316730 GATAATTGTTTTGTTTAAGGAGG - Intronic
1199926495 X:152471715-152471737 GAAGATTGTTTTGTTTGAGGAGG - Intergenic
1200317940 X:155154118-155154140 AATAATTGTTTTGTTTAAGGAGG + Intergenic
1200332833 X:155315458-155315480 GATAATTGTTTTGTTTAAGGAGG - Intronic
1200415017 Y:2900530-2900552 GATAATTGTTTTGTTTGAAGAGG - Intronic
1200442590 Y:3229358-3229380 GACAGTTGTTTTGTTTAAGGAGG + Intergenic
1200447806 Y:3287075-3287097 TATAATTGTTTTGTTTAAGGAGG + Intergenic
1200511774 Y:4087320-4087342 GATAATTGTTTTGTTTAAGGGGG - Intergenic
1200530557 Y:4330621-4330643 GATAATTGTTTTGTTTAAGGAGG + Intergenic
1200538470 Y:4429476-4429498 AATAATTATTTTGTTTCAGGAGG + Intergenic
1200561217 Y:4706471-4706493 GATAATTATTTTGTTTAAGATGG + Intergenic
1200738357 Y:6826258-6826280 GGTAATTATTTTATTTAAGGAGG + Intergenic
1201307853 Y:12566370-12566392 GATAATTGTTTTGCTTGAGGAGG + Intergenic
1201315959 Y:12645543-12645565 GATAATTGTTTAGTTTGAGGAGG - Intergenic
1201715541 Y:17040918-17040940 TATAACTTTTTTGTGTAAGTGGG - Intergenic
1201934588 Y:19394612-19394634 GATAATTGCTTCATTTAAGGAGG + Intergenic
1202043810 Y:20715721-20715743 GATAATTGCTTTGTTTGAGGAGG - Intergenic