ID: 1177681226

View in Genome Browser
Species Human (GRCh38)
Location 21:24374176-24374198
Sequence TGTTTTGTTTAAGGAGGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177681223_1177681226 5 Left 1177681223 21:24374148-24374170 CCTGTATACAAAATTCTTGGCTG No data
Right 1177681226 21:24374176-24374198 TGTTTTGTTTAAGGAGGCTAAGG No data
1177681220_1177681226 13 Left 1177681220 21:24374140-24374162 CCAGTTTCCCTGTATACAAAATT No data
Right 1177681226 21:24374176-24374198 TGTTTTGTTTAAGGAGGCTAAGG No data
1177681222_1177681226 6 Left 1177681222 21:24374147-24374169 CCCTGTATACAAAATTCTTGGCT No data
Right 1177681226 21:24374176-24374198 TGTTTTGTTTAAGGAGGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177681226 Original CRISPR TGTTTTGTTTAAGGAGGCTA AGG Intergenic
No off target data available for this crispr