ID: 1177681227

View in Genome Browser
Species Human (GRCh38)
Location 21:24374181-24374203
Sequence TGTTTAAGGAGGCTAAGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177681223_1177681227 10 Left 1177681223 21:24374148-24374170 CCTGTATACAAAATTCTTGGCTG No data
Right 1177681227 21:24374181-24374203 TGTTTAAGGAGGCTAAGGACAGG No data
1177681220_1177681227 18 Left 1177681220 21:24374140-24374162 CCAGTTTCCCTGTATACAAAATT No data
Right 1177681227 21:24374181-24374203 TGTTTAAGGAGGCTAAGGACAGG No data
1177681222_1177681227 11 Left 1177681222 21:24374147-24374169 CCCTGTATACAAAATTCTTGGCT No data
Right 1177681227 21:24374181-24374203 TGTTTAAGGAGGCTAAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177681227 Original CRISPR TGTTTAAGGAGGCTAAGGAC AGG Intergenic
No off target data available for this crispr