ID: 1177692585

View in Genome Browser
Species Human (GRCh38)
Location 21:24530947-24530969
Sequence TGAGACAATGAGAGTAATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177692585_1177692587 26 Left 1177692585 21:24530947-24530969 CCCAGATTACTCTCATTGTCTCA No data
Right 1177692587 21:24530996-24531018 TATAATTTTTAATCCATTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177692585 Original CRISPR TGAGACAATGAGAGTAATCT GGG (reversed) Intergenic
No off target data available for this crispr