ID: 1177693691

View in Genome Browser
Species Human (GRCh38)
Location 21:24543571-24543593
Sequence GTCAGGCTGCACCACGTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177693691_1177693695 11 Left 1177693691 21:24543571-24543593 CCCACTACGTGGTGCAGCCTGAC No data
Right 1177693695 21:24543605-24543627 AAATCATTGATTCTTACCAGTGG No data
1177693691_1177693696 17 Left 1177693691 21:24543571-24543593 CCCACTACGTGGTGCAGCCTGAC No data
Right 1177693696 21:24543611-24543633 TTGATTCTTACCAGTGGACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177693691 Original CRISPR GTCAGGCTGCACCACGTAGT GGG (reversed) Intergenic