ID: 1177694608

View in Genome Browser
Species Human (GRCh38)
Location 21:24555331-24555353
Sequence TCATCTATAAGCCCCTGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177694608_1177694611 -5 Left 1177694608 21:24555331-24555353 CCCAGTCAGGGGCTTATAGATGA No data
Right 1177694611 21:24555349-24555371 GATGAAACTCCCATCTCCCTGGG No data
1177694608_1177694619 16 Left 1177694608 21:24555331-24555353 CCCAGTCAGGGGCTTATAGATGA No data
Right 1177694619 21:24555370-24555392 GGACAGAGCACCTGGAAGGAGGG No data
1177694608_1177694614 8 Left 1177694608 21:24555331-24555353 CCCAGTCAGGGGCTTATAGATGA No data
Right 1177694614 21:24555362-24555384 TCTCCCTGGGACAGAGCACCTGG No data
1177694608_1177694621 20 Left 1177694608 21:24555331-24555353 CCCAGTCAGGGGCTTATAGATGA No data
Right 1177694621 21:24555374-24555396 AGAGCACCTGGAAGGAGGGGTGG No data
1177694608_1177694618 15 Left 1177694608 21:24555331-24555353 CCCAGTCAGGGGCTTATAGATGA No data
Right 1177694618 21:24555369-24555391 GGGACAGAGCACCTGGAAGGAGG No data
1177694608_1177694624 27 Left 1177694608 21:24555331-24555353 CCCAGTCAGGGGCTTATAGATGA No data
Right 1177694624 21:24555381-24555403 CTGGAAGGAGGGGTGGCTGTGGG No data
1177694608_1177694610 -6 Left 1177694608 21:24555331-24555353 CCCAGTCAGGGGCTTATAGATGA No data
Right 1177694610 21:24555348-24555370 AGATGAAACTCCCATCTCCCTGG No data
1177694608_1177694617 12 Left 1177694608 21:24555331-24555353 CCCAGTCAGGGGCTTATAGATGA No data
Right 1177694617 21:24555366-24555388 CCTGGGACAGAGCACCTGGAAGG No data
1177694608_1177694620 17 Left 1177694608 21:24555331-24555353 CCCAGTCAGGGGCTTATAGATGA No data
Right 1177694620 21:24555371-24555393 GACAGAGCACCTGGAAGGAGGGG No data
1177694608_1177694623 26 Left 1177694608 21:24555331-24555353 CCCAGTCAGGGGCTTATAGATGA No data
Right 1177694623 21:24555380-24555402 CCTGGAAGGAGGGGTGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177694608 Original CRISPR TCATCTATAAGCCCCTGACT GGG (reversed) Intergenic