ID: 1177698033

View in Genome Browser
Species Human (GRCh38)
Location 21:24598879-24598901
Sequence GTGTTATCTCTCATGGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177698029_1177698033 25 Left 1177698029 21:24598831-24598853 CCAGACTCTCTGGATTTTAATTT No data
Right 1177698033 21:24598879-24598901 GTGTTATCTCTCATGGAACAGGG No data
1177698028_1177698033 26 Left 1177698028 21:24598830-24598852 CCCAGACTCTCTGGATTTTAATT No data
Right 1177698033 21:24598879-24598901 GTGTTATCTCTCATGGAACAGGG No data
1177698030_1177698033 -3 Left 1177698030 21:24598859-24598881 CCAAGCATAATTTCAATTTTGTG No data
Right 1177698033 21:24598879-24598901 GTGTTATCTCTCATGGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177698033 Original CRISPR GTGTTATCTCTCATGGAACA GGG Intergenic
No off target data available for this crispr