ID: 1177701858

View in Genome Browser
Species Human (GRCh38)
Location 21:24649178-24649200
Sequence CCAGCAAAATAGTTTAAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177701858_1177701865 22 Left 1177701858 21:24649178-24649200 CCACCTTTAAACTATTTTGCTGG No data
Right 1177701865 21:24649223-24649245 GTAACAACTTTTTTTTGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177701858 Original CRISPR CCAGCAAAATAGTTTAAAGG TGG (reversed) Intergenic
No off target data available for this crispr