ID: 1177705596

View in Genome Browser
Species Human (GRCh38)
Location 21:24699946-24699968
Sequence CTTTGTATAAGGTGCAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177705593_1177705596 -8 Left 1177705593 21:24699931-24699953 CCATCTTCAGTTAATCTTTGTAT No data
Right 1177705596 21:24699946-24699968 CTTTGTATAAGGTGCAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177705596 Original CRISPR CTTTGTATAAGGTGCAAGGA AGG Intergenic
No off target data available for this crispr