ID: 1177717537

View in Genome Browser
Species Human (GRCh38)
Location 21:24858724-24858746
Sequence AAAGGTTTTTTGACCCATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177717534_1177717537 23 Left 1177717534 21:24858678-24858700 CCTGTCACTAAAAAAAAGAAAAG No data
Right 1177717537 21:24858724-24858746 AAAGGTTTTTTGACCCATATGGG No data
1177717533_1177717537 24 Left 1177717533 21:24858677-24858699 CCCTGTCACTAAAAAAAAGAAAA No data
Right 1177717537 21:24858724-24858746 AAAGGTTTTTTGACCCATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177717537 Original CRISPR AAAGGTTTTTTGACCCATAT GGG Intergenic
No off target data available for this crispr