ID: 1177724280

View in Genome Browser
Species Human (GRCh38)
Location 21:24946940-24946962
Sequence ACTGCTCCACATACTTACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177724277_1177724280 20 Left 1177724277 21:24946897-24946919 CCGCAATTACTTTTGCATCACCT No data
Right 1177724280 21:24946940-24946962 ACTGCTCCACATACTTACCAAGG No data
1177724278_1177724280 0 Left 1177724278 21:24946917-24946939 CCTAATAGTATATAAATGTCTCC No data
Right 1177724280 21:24946940-24946962 ACTGCTCCACATACTTACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177724280 Original CRISPR ACTGCTCCACATACTTACCA AGG Intergenic
No off target data available for this crispr