ID: 1177732177

View in Genome Browser
Species Human (GRCh38)
Location 21:25041762-25041784
Sequence GCAGCTCCTTTGATTCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177732177_1177732179 23 Left 1177732177 21:25041762-25041784 CCAGGCTGAATCAAAGGAGCTGC No data
Right 1177732179 21:25041808-25041830 TCCTTACACAGATGCTCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177732177 Original CRISPR GCAGCTCCTTTGATTCAGCC TGG (reversed) Intergenic
No off target data available for this crispr