ID: 1177734367

View in Genome Browser
Species Human (GRCh38)
Location 21:25070496-25070518
Sequence ACCTATTTCTGTCCTCCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177734364_1177734367 0 Left 1177734364 21:25070473-25070495 CCTGTCACATTCTACTTCTGCCC No data
Right 1177734367 21:25070496-25070518 ACCTATTTCTGTCCTCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177734367 Original CRISPR ACCTATTTCTGTCCTCCTCT TGG Intergenic
No off target data available for this crispr