ID: 1177734789

View in Genome Browser
Species Human (GRCh38)
Location 21:25075490-25075512
Sequence GTGAAAGGACTCCCTAAATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177734786_1177734789 -7 Left 1177734786 21:25075474-25075496 CCAATAATAAGCAATGGTGAAAG No data
Right 1177734789 21:25075490-25075512 GTGAAAGGACTCCCTAAATAGGG No data
1177734783_1177734789 23 Left 1177734783 21:25075444-25075466 CCTACAACTACCTGATGATAAAC No data
Right 1177734789 21:25075490-25075512 GTGAAAGGACTCCCTAAATAGGG No data
1177734784_1177734789 13 Left 1177734784 21:25075454-25075476 CCTGATGATAAACAAAGTCACCA No data
Right 1177734789 21:25075490-25075512 GTGAAAGGACTCCCTAAATAGGG No data
1177734782_1177734789 30 Left 1177734782 21:25075437-25075459 CCACACACCTACAACTACCTGAT No data
Right 1177734789 21:25075490-25075512 GTGAAAGGACTCCCTAAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177734789 Original CRISPR GTGAAAGGACTCCCTAAATA GGG Intergenic