ID: 1177734789 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 21:25075490-25075512 |
| Sequence | GTGAAAGGACTCCCTAAATA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1177734786_1177734789 | -7 | Left | 1177734786 | 21:25075474-25075496 | CCAATAATAAGCAATGGTGAAAG | No data | ||
| Right | 1177734789 | 21:25075490-25075512 | GTGAAAGGACTCCCTAAATAGGG | No data | ||||
| 1177734783_1177734789 | 23 | Left | 1177734783 | 21:25075444-25075466 | CCTACAACTACCTGATGATAAAC | No data | ||
| Right | 1177734789 | 21:25075490-25075512 | GTGAAAGGACTCCCTAAATAGGG | No data | ||||
| 1177734784_1177734789 | 13 | Left | 1177734784 | 21:25075454-25075476 | CCTGATGATAAACAAAGTCACCA | No data | ||
| Right | 1177734789 | 21:25075490-25075512 | GTGAAAGGACTCCCTAAATAGGG | No data | ||||
| 1177734782_1177734789 | 30 | Left | 1177734782 | 21:25075437-25075459 | CCACACACCTACAACTACCTGAT | No data | ||
| Right | 1177734789 | 21:25075490-25075512 | GTGAAAGGACTCCCTAAATAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1177734789 | Original CRISPR | GTGAAAGGACTCCCTAAATA GGG | Intergenic | ||