ID: 1177737404

View in Genome Browser
Species Human (GRCh38)
Location 21:25108654-25108676
Sequence AAGACTGCCCCTGACTTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177737400_1177737404 21 Left 1177737400 21:25108610-25108632 CCAGAGTTAACATCAGATCCTAT No data
Right 1177737404 21:25108654-25108676 AAGACTGCCCCTGACTTCAGAGG No data
1177737402_1177737404 3 Left 1177737402 21:25108628-25108650 CCTATGTGTTAAGGACTCAGTTC No data
Right 1177737404 21:25108654-25108676 AAGACTGCCCCTGACTTCAGAGG No data
1177737399_1177737404 22 Left 1177737399 21:25108609-25108631 CCCAGAGTTAACATCAGATCCTA No data
Right 1177737404 21:25108654-25108676 AAGACTGCCCCTGACTTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177737404 Original CRISPR AAGACTGCCCCTGACTTCAG AGG Intergenic