ID: 1177738119

View in Genome Browser
Species Human (GRCh38)
Location 21:25118775-25118797
Sequence CGGGGAACAGCAGTGGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177738119_1177738131 23 Left 1177738119 21:25118775-25118797 CCCTCTACCACTGCTGTTCCCCG No data
Right 1177738131 21:25118821-25118843 TCCACCCCTCCGGATCCGGCAGG 0: 12
1: 72
2: 148
3: 164
4: 147
1177738119_1177738128 13 Left 1177738119 21:25118775-25118797 CCCTCTACCACTGCTGTTCCCCG No data
Right 1177738128 21:25118811-25118833 GCCGCTGACTTCCACCCCTCCGG 0: 21
1: 71
2: 115
3: 97
4: 145
1177738119_1177738130 19 Left 1177738119 21:25118775-25118797 CCCTCTACCACTGCTGTTCCCCG No data
Right 1177738130 21:25118817-25118839 GACTTCCACCCCTCCGGATCCGG 0: 31
1: 87
2: 117
3: 65
4: 76
1177738119_1177738133 24 Left 1177738119 21:25118775-25118797 CCCTCTACCACTGCTGTTCCCCG No data
Right 1177738133 21:25118822-25118844 CCACCCCTCCGGATCCGGCAGGG 0: 14
1: 74
2: 165
3: 149
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177738119 Original CRISPR CGGGGAACAGCAGTGGTAGA GGG (reversed) Intergenic
No off target data available for this crispr