ID: 1177738823

View in Genome Browser
Species Human (GRCh38)
Location 21:25127882-25127904
Sequence AACTGAATCATTCTTCTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177738822_1177738823 -7 Left 1177738822 21:25127866-25127888 CCACAGTTTCATTGACAACTGAA No data
Right 1177738823 21:25127882-25127904 AACTGAATCATTCTTCTCTCTGG No data
1177738820_1177738823 -5 Left 1177738820 21:25127864-25127886 CCCCACAGTTTCATTGACAACTG No data
Right 1177738823 21:25127882-25127904 AACTGAATCATTCTTCTCTCTGG No data
1177738821_1177738823 -6 Left 1177738821 21:25127865-25127887 CCCACAGTTTCATTGACAACTGA No data
Right 1177738823 21:25127882-25127904 AACTGAATCATTCTTCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177738823 Original CRISPR AACTGAATCATTCTTCTCTC TGG Intergenic
No off target data available for this crispr