ID: 1177741762

View in Genome Browser
Species Human (GRCh38)
Location 21:25162857-25162879
Sequence GCCTGAAGACATTTTTCATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177741762_1177741763 2 Left 1177741762 21:25162857-25162879 CCTTATGAAAAATGTCTTCAGGC No data
Right 1177741763 21:25162882-25162904 TTTATTTTTCTATAAGTATTTGG No data
1177741762_1177741764 18 Left 1177741762 21:25162857-25162879 CCTTATGAAAAATGTCTTCAGGC No data
Right 1177741764 21:25162898-25162920 TATTTGGAAAACATTTATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177741762 Original CRISPR GCCTGAAGACATTTTTCATA AGG (reversed) Intergenic
No off target data available for this crispr