ID: 1177743289

View in Genome Browser
Species Human (GRCh38)
Location 21:25179558-25179580
Sequence ACTTATAAGTAAAAGTTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177743289_1177743291 10 Left 1177743289 21:25179558-25179580 CCTTTCAACTTTTACTTATAAGT No data
Right 1177743291 21:25179591-25179613 TCAATTTAGCATCAGAAAGCAGG No data
1177743289_1177743292 11 Left 1177743289 21:25179558-25179580 CCTTTCAACTTTTACTTATAAGT No data
Right 1177743292 21:25179592-25179614 CAATTTAGCATCAGAAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177743289 Original CRISPR ACTTATAAGTAAAAGTTGAA AGG (reversed) Intergenic
No off target data available for this crispr